Incidental Mutation 'R7329:Actb'
ID569105
Institutional Source Beutler Lab
Gene Symbol Actb
Ensembl Gene ENSMUSG00000029580
Gene Nameactin, beta
SynonymsActx, A-X actin-like protein, E430023M04Rik, beta-actin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142903115-142906754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142904391 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 252 (N252S)
Ref Sequence ENSEMBL: ENSMUSP00000098066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100497] [ENSMUST00000106216] [ENSMUST00000163829] [ENSMUST00000167721] [ENSMUST00000171419]
Predicted Effect probably benign
Transcript: ENSMUST00000100497
AA Change: N252S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000098066
Gene: ENSMUSG00000029580
AA Change: N252S

DomainStartEndE-ValueType
ACTIN 5 375 1.67e-243 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106216
SMART Domains Protein: ENSMUSP00000101823
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 8 150 8.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163829
SMART Domains Protein: ENSMUSP00000132135
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
Pfam:Actin 2 58 8.5e-18 PFAM
Pfam:Actin 52 108 6.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167721
AA Change: N172S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127663
Gene: ENSMUSG00000029580
AA Change: N172S

DomainStartEndE-ValueType
ACTIN 5 295 1.84e-149 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171419
AA Change: N252S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130611
Gene: ENSMUSG00000029580
AA Change: N252S

DomainStartEndE-ValueType
ACTIN 5 265 3.43e-117 SMART
Meta Mutation Damage Score 0.1813 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes a member of the actin family of proteins. Actins are highly conserved proteins that are among the most abundant proteins in eukaryotic cells and are involved in cell motility, structure, and integrity. Localization, stability, and translation of the transcribed mRNA are regulated through the binding of multiple factors to its 3' UTR sequence. Homozygous knockout mice for this gene exhibit embryonic lethality. Numerous pseudogenes of this gene have been identified in the mouse genome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Homozygotes for a hypomorphic targeted mutation develop normally until embryonic day 8.5; are growth retarded by day 9.5 and die shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Actb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Actb APN 5 142904436 missense probably damaging 0.97
R1612:Actb UTSW 5 142905595 missense probably damaging 1.00
R4872:Actb UTSW 5 142905552 splice site probably benign
R5305:Actb UTSW 5 142904230 missense probably benign 0.27
R5424:Actb UTSW 5 142905551 splice site probably benign
R7748:Actb UTSW 5 142904695 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATGTCAACGTCACACTTCATG -3'
(R):5'- CCTCATGAAGATCCTGACCG -3'

Sequencing Primer
(F):5'- CGTCACACTTCATGATGGAATTG -3'
(R):5'- TGAAGATCCTGACCGAGCGTG -3'
Posted On2019-09-13