Mutagenetix > Incidental Mutation

Incidental Mutation 'R7329:Cntnap2'

569106

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7329 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47271271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1204 (V1204M)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060839] [ENSMUST00000114641] [ENSMUST00000199100]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000060839

SMART Domains

Protein: ENSMUSP00000056299
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114641
AA Change: V1204M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: V1204M

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199100

SMART Domains

Protein: ENSMUSP00000143528
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	T	C	19: 58,789,222	E52G	probably damaging	Het
Actb	T	C	5: 142,904,391	N252S	probably benign	Het
Adgrb1	C	A	15: 74,539,245	T330K	probably damaging	Het
Ahnak	A	G	19: 9,001,792	T147A	probably damaging	Het
Ankfy1	T	C	11: 72,712,208	V21A	probably damaging	Het
Arrdc4	T	A	7: 68,741,027	N322Y	probably damaging	Het
Bfsp2	C	A	9: 103,449,922	E205D	probably benign	Het
C2cd4b	T	A	9: 67,760,137	S138R	possibly damaging	Het
Camkk1	C	G	11: 73,027,047	N147K	probably damaging	Het
Ckap2l	T	A	2: 129,285,364	Q298L	possibly damaging	Het
Clstn2	G	T	9: 97,461,369	A675D	probably benign	Het
Col4a1	C	T	8: 11,226,494		probably null	Het
Ctrc	T	C	4: 141,843,711	T73A	probably benign	Het
Cubn	A	G	2: 13,468,771	F454L	probably damaging	Het
Cuedc1	A	T	11: 88,169,866	S12C	unknown	Het
Cyb561a3	G	T	19: 10,587,904	G211C	probably damaging	Het
D5Ertd579e	A	T	5: 36,616,395	S219T	probably benign	Het
Dennd4c	C	T	4: 86,779,874	P200S	possibly damaging	Het
Dennd4c	T	A	4: 86,841,081	Y1783N	probably damaging	Het
Dnah6	G	A	6: 73,144,722	Q1426*	probably null	Het
Dync2h1	T	G	9: 7,011,247	T3649P	probably benign	Het
E2f8	T	C	7: 48,872,110	S415G	probably damaging	Het
Fbxo22	A	G	9: 55,214,977	I147V	probably benign	Het
Gclc	A	G	9: 77,776,191	Y110C	probably damaging	Het
Gm15922	G	A	7: 3,739,876		probably benign	Het
Gstm5	A	G	3: 107,896,331	T27A	possibly damaging	Het
Heatr4	A	G	12: 83,978,082	S322P	probably benign	Het
Htt	T	A	5: 34,829,755	I1106N	probably benign	Het
Hunk	T	C	16: 90,386,682	V76A	probably benign	Het
Igkv12-98	C	T	6: 68,571,103	T72I	possibly damaging	Het
Igkv9-123	A	T	6: 67,954,645	W16R	possibly damaging	Het
Ipo7	T	C	7: 110,049,017	L674S	possibly damaging	Het
Kcnh6	T	C	11: 106,017,377	F273S	probably benign	Het
Lamb3	C	A	1: 193,320,540	Q98K	possibly damaging	Het
Lingo4	A	T	3: 94,402,855	T367S	probably benign	Het
Lypd6b	A	T	2: 49,942,500	I26F	probably benign	Het
Maneal	T	C	4: 124,856,719	T415A	probably benign	Het
Mapk1ip1l	A	G	14: 47,310,463	T23A	unknown	Het
Mrps17	T	A	5: 129,716,641		probably benign	Het
Mup13	T	G	4: 61,227,689	D45A	probably damaging	Het
Mycbpap	T	A	11: 94,509,247	D408V	probably damaging	Het
Myh10	A	G	11: 68,810,191	H1742R	probably benign	Het
Mylk4	A	G	13: 32,716,783	Y255H	probably damaging	Het
Nbeal1	A	G	1: 60,217,196	Q200R	probably benign	Het
Nkain2	TTTACTCGTT	TTT	10: 32,889,896		probably null	Het
Olfm4	T	C	14: 80,011,929	V162A	possibly damaging	Het
Olfr1151	T	C	2: 87,857,241	V22A	probably benign	Het
Olfr251	C	A	9: 38,378,160	T87K	probably benign	Het
Olfr344	A	G	2: 36,568,696	T33A	probably benign	Het
Olfr570	T	C	7: 102,900,832	L155P	probably damaging	Het
Ovol3	T	A	7: 30,235,252	R43S	probably benign	Het
Pcbp1	A	G	6: 86,525,116	V267A	probably benign	Het
Phf20	T	A	2: 156,304,632	V903E	probably damaging	Het
Pi4k2b	T	G	5: 52,756,869	S316A	probably benign	Het
Pkhd1	A	T	1: 20,547,519	H947Q	probably damaging	Het
Ppip5k2	A	C	1: 97,750,753		probably null	Het
Prkca	T	A	11: 108,014,277	T212S	possibly damaging	Het
Psg16	A	T	7: 17,090,686	I41F	possibly damaging	Het
Rae1	T	A	2: 173,009,445	F204I	probably benign	Het
Rasef	T	A	4: 73,744,137	N192I	probably damaging	Het
Rfc1	T	A	5: 65,263,135	R1122S	unknown	Het
Rfx2	A	T	17: 56,803,681	S102T	probably benign	Het
Sez6l	A	G	5: 112,440,907	Y647H	probably damaging	Het
Siglecf	A	G	7: 43,351,971	Y121C	probably damaging	Het
Slc27a5	T	C	7: 12,991,162	T453A	possibly damaging	Het
Slc44a2	G	A	9: 21,342,752	R171Q	probably damaging	Het
Slc4a9	A	C	18: 36,540,821	E889A	possibly damaging	Het
Snx31	C	A	15: 36,555,476	R13L	probably benign	Het
Spag6l	A	T	16: 16,767,019	Y422N	probably benign	Het
Sulf2	T	C	2: 166,117,088	T67A	probably damaging	Het
Syne2	G	A	12: 75,966,984	R2983Q	probably benign	Het
Tmtc3	A	G	10: 100,447,419	I758T	probably benign	Het
Top2a	T	A	11: 99,004,246	I843L	possibly damaging	Het
Tph1	T	C	7: 46,656,861		probably null	Het
Trdmt1	A	G	2: 13,516,122	L323P	probably damaging	Het
Ush2a	A	T	1: 188,553,198	E1977V	probably damaging	Het
Utp4	A	G	8: 106,913,463	E468G	probably benign	Het
Uts2r	A	G	11: 121,160,732	T141A	possibly damaging	Het
Vmn1r230	A	G	17: 20,846,690	Y47C	probably damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGAGCTTAGGACACAAGCGC -3'
(R):5'- TAGTCAACCCATTCTATAGCGGAG -3'

Sequencing Primer
(F):5'- ATGGGTCTGTCTTCCAACAG -3'
(R):5'- TCAACCCATTCTATAGCGGAGGAAAG -3'

Posted On

2019-09-13