Incidental Mutation 'R7329:Slc27a5'
ID569112
Institutional Source Beutler Lab
Gene Symbol Slc27a5
Ensembl Gene ENSMUSG00000030382
Gene Namesolute carrier family 27 (fatty acid transporter), member 5
SynonymsVLCSH2, FATP5, FACVL3, VLCS-H2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12988346-12998192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12991162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 453 (T453A)
Ref Sequence ENSEMBL: ENSMUSP00000032539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032539] [ENSMUST00000120903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032539
AA Change: T453A

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032539
Gene: ENSMUSG00000030382
AA Change: T453A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 557 1.3e-64 PFAM
Pfam:AMP-binding_C 565 641 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120903
SMART Domains Protein: ENSMUSP00000112495
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 414 2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133977
SMART Domains Protein: ENSMUSP00000117208
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
Pfam:AMP-binding 1 102 3.3e-8 PFAM
Pfam:AMP-binding 100 195 1.3e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of very long-chain acyl-CoA synthetase (VLCS). It is capable of activating very long-chain fatty-acids containing 24- and 26-carbons. It is expressed in liver and associated with endoplasmic reticulum but not with peroxisomes. Its primary role is in fatty acid elongation or complex lipid synthesis rather than in degradation. This gene has a mouse ortholog. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Slc27a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc27a5 APN 7 12988639 missense probably benign 0.08
IGL00906:Slc27a5 APN 7 12991057 missense probably benign 0.00
IGL01067:Slc27a5 APN 7 12989072 missense probably damaging 1.00
IGL02101:Slc27a5 APN 7 12993343 missense possibly damaging 0.95
IGL02148:Slc27a5 APN 7 12994951 missense probably damaging 0.97
IGL02165:Slc27a5 APN 7 12994948 missense probably damaging 0.99
IGL02324:Slc27a5 APN 7 12997560 missense probably benign 0.00
IGL02879:Slc27a5 APN 7 12995044 splice site probably benign
R1519:Slc27a5 UTSW 7 12988459 splice site probably null
R1662:Slc27a5 UTSW 7 12991246 missense probably damaging 1.00
R1774:Slc27a5 UTSW 7 12997607 nonsense probably null
R2012:Slc27a5 UTSW 7 12997707 missense probably damaging 0.98
R2020:Slc27a5 UTSW 7 12993412 missense probably damaging 1.00
R2886:Slc27a5 UTSW 7 12989560 unclassified probably benign
R4234:Slc27a5 UTSW 7 12988443 missense probably benign 0.01
R4855:Slc27a5 UTSW 7 12988633 missense probably benign 0.00
R5126:Slc27a5 UTSW 7 12991320 missense probably damaging 1.00
R5450:Slc27a5 UTSW 7 12994942 missense probably benign 0.04
R5712:Slc27a5 UTSW 7 12998083 unclassified probably benign
R6302:Slc27a5 UTSW 7 12988552 missense probably damaging 1.00
R6346:Slc27a5 UTSW 7 12990972 missense possibly damaging 0.75
R6866:Slc27a5 UTSW 7 12997516 missense probably benign 0.00
R6921:Slc27a5 UTSW 7 12991208 missense probably damaging 1.00
R8017:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
R8019:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
R8312:Slc27a5 UTSW 7 12991287 missense probably damaging 1.00
R8793:Slc27a5 UTSW 7 12989369 missense probably benign 0.16
Z1177:Slc27a5 UTSW 7 12988855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTGTTTGTCCCTCAGAG -3'
(R):5'- AGAGTTCCTAGCCATACCCTAC -3'

Sequencing Primer
(F):5'- CAGAGGCTCTGCTGTCTCTATG -3'
(R):5'- GATGTCCCTGCAGCAACCAG -3'
Posted On2019-09-13