Incidental Mutation 'R7329:Ovol3'
ID569114
Institutional Source Beutler Lab
Gene Symbol Ovol3
Ensembl Gene ENSMUSG00000100512
Gene Nameovo like zinc finger 3
Synonymsmovo3, LOC381867
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30233439-30235725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30235252 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 43 (R43S)
Ref Sequence ENSEMBL: ENSMUSP00000140811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006254] [ENSMUST00000019882] [ENSMUST00000108190] [ENSMUST00000108192] [ENSMUST00000108193] [ENSMUST00000134570] [ENSMUST00000145027] [ENSMUST00000149654] [ENSMUST00000189482]
Predicted Effect probably benign
Transcript: ENSMUST00000006254
SMART Domains Protein: ENSMUSP00000006254
Gene: ENSMUSG00000006095

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 10 94 9.6e-30 PFAM
low complexity region 135 152 N/A INTRINSIC
CAP_GLY 161 230 4.76e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019882
SMART Domains Protein: ENSMUSP00000019882
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 15 68 1.22e-24 SMART
ZnF_C2C2 84 125 2.18e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108190
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108192
SMART Domains Protein: ENSMUSP00000103827
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
ZnF_C2C2 62 103 2.18e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108193
SMART Domains Protein: ENSMUSP00000103828
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
Pfam:RNA_POL_M_15KD 14 41 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134570
SMART Domains Protein: ENSMUSP00000116139
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
WD40 36 75 2.77e-1 SMART
WD40 78 120 2.3e0 SMART
WD40 124 164 4.18e-2 SMART
WD40 169 211 1.54e0 SMART
WD40 214 256 8.49e-3 SMART
WD40 259 298 3.61e-6 SMART
low complexity region 317 322 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 512 519 N/A INTRINSIC
low complexity region 744 755 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 1006 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145027
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149654
SMART Domains Protein: ENSMUSP00000116741
Gene: ENSMUSG00000019738

DomainStartEndE-ValueType
RPOL9 1 46 5.45e-13 SMART
Blast:ZnF_C2C2 62 83 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189482
AA Change: R43S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140811
Gene: ENSMUSG00000100512
AA Change: R43S

DomainStartEndE-ValueType
ZnF_C2H2 69 91 3.2e-4 SMART
ZnF_C2H2 97 119 1.4e-6 SMART
ZnF_C2H2 125 148 3.2e-5 SMART
ZnF_C2H2 164 186 5.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Ovol3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4425:Ovol3 UTSW 7 30235364 critical splice donor site probably null
R5235:Ovol3 UTSW 7 30233474 missense possibly damaging 0.95
R5331:Ovol3 UTSW 7 30233479 missense possibly damaging 0.57
R6050:Ovol3 UTSW 7 30234394 missense probably benign
R6454:Ovol3 UTSW 7 30235375 missense probably damaging 1.00
R7438:Ovol3 UTSW 7 30235221 critical splice donor site probably null
R7566:Ovol3 UTSW 7 30234366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGACTGGGTTGAGCTG -3'
(R):5'- ATGCCCAGGGTCTTTCTTG -3'

Sequencing Primer
(F):5'- AGCTGGGTCCTGGGAAG -3'
(R):5'- CTTGTGAGGAGTCGGCGTCC -3'
Posted On2019-09-13