Incidental Mutation 'R7329:Mycbpap'
ID569136
Institutional Source Beutler Lab
Gene Symbol Mycbpap
Ensembl Gene ENSMUSG00000039110
Gene NameMYCBP associated protein
SynonymsAMAP-1, 4932408B01Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_170671.2; MGI: 2388726

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94501347-94521742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94509247 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 408 (D408V)
Ref Sequence ENSEMBL: ENSMUSP00000091477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040692] [ENSMUST00000093945]
Predicted Effect probably benign
Transcript: ENSMUST00000040692
SMART Domains Protein: ENSMUSP00000047579
Gene: ENSMUSG00000039110

DomainStartEndE-ValueType
Pfam:MYCBPAP 6 85 2.3e-19 PFAM
low complexity region 330 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093945
AA Change: D408V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091477
Gene: ENSMUSG00000039110
AA Change: D408V

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:MYCBPAP 184 602 3.7e-144 PFAM
low complexity region 848 860 N/A INTRINSIC
Meta Mutation Damage Score 0.1340 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Mycbpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Mycbpap APN 11 94509319 unclassified probably null
IGL01372:Mycbpap APN 11 94506456 missense possibly damaging 0.56
IGL01627:Mycbpap APN 11 94514604 missense probably damaging 0.98
IGL01645:Mycbpap APN 11 94503467 splice site probably null
IGL01712:Mycbpap APN 11 94512655 missense possibly damaging 0.50
IGL02209:Mycbpap APN 11 94509882 splice site probably benign
IGL02377:Mycbpap APN 11 94503250 missense probably damaging 1.00
IGL03088:Mycbpap APN 11 94513943 critical splice acceptor site probably null
IGL03412:Mycbpap APN 11 94508101 splice site probably null
IGL03046:Mycbpap UTSW 11 94505717 missense possibly damaging 0.84
P0008:Mycbpap UTSW 11 94504067 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0437:Mycbpap UTSW 11 94513512 splice site probably benign
R0706:Mycbpap UTSW 11 94513786 nonsense probably null
R0791:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1496:Mycbpap UTSW 11 94505561 missense probably benign 0.11
R1522:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1698:Mycbpap UTSW 11 94508143 nonsense probably null
R1796:Mycbpap UTSW 11 94507551 missense probably damaging 1.00
R1906:Mycbpap UTSW 11 94505621 missense probably benign 0.24
R4115:Mycbpap UTSW 11 94512225 splice site probably null
R4930:Mycbpap UTSW 11 94503157 missense probably benign 0.20
R4965:Mycbpap UTSW 11 94504938 missense probably damaging 1.00
R5323:Mycbpap UTSW 11 94503504 missense probably benign 0.00
R5326:Mycbpap UTSW 11 94507746 splice site probably null
R5542:Mycbpap UTSW 11 94507746 splice site probably null
R5625:Mycbpap UTSW 11 94505693 missense probably damaging 0.99
R5841:Mycbpap UTSW 11 94505610 missense probably damaging 1.00
R5996:Mycbpap UTSW 11 94513594 missense probably benign
R6065:Mycbpap UTSW 11 94508187 unclassified probably null
R6192:Mycbpap UTSW 11 94507731 missense probably damaging 1.00
R7027:Mycbpap UTSW 11 94514614 missense probably damaging 1.00
R7513:Mycbpap UTSW 11 94503556 missense probably damaging 1.00
Z1177:Mycbpap UTSW 11 94509854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATCTCACTTCTGCTTGAG -3'
(R):5'- TGCATAGAGAATAACCGCGG -3'

Sequencing Primer
(F):5'- GATCTCACTTCTGCTTGAGTTAGTGC -3'
(R):5'- CAGACTGACTGGCTCTCTGTG -3'
Posted On2019-09-13