Incidental Mutation 'R7329:Top2a'
ID569137
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99004246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 843 (I843L)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068031
AA Change: I843L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: I843L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R7924:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7977:Top2a UTSW 11 99009605 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTGATGAGAAACAGTTCCAACC -3'
(R):5'- GCCCCACCAATCTTGAACTTG -3'

Sequencing Primer
(F):5'- CCAGAGCACTTACCATGGGTAG -3'
(R):5'- TTTGTCCACCAAGTGCAGG -3'
Posted On2019-09-13