Incidental Mutation 'R7329:Kcnh6'
ID569138
Institutional Source Beutler Lab
Gene Symbol Kcnh6
Ensembl Gene ENSMUSG00000001901
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 6
Synonymsm-erg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106008124-106034549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106017377 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 273 (F273S)
Ref Sequence ENSEMBL: ENSMUSP00000001965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
AA Change: F273S

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: F273S

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106903
AA Change: F273S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: F273S

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
AA Change: F273S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: F273S

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Meta Mutation Damage Score 0.2004 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Kcnh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnh6 APN 11 106019019 missense probably damaging 1.00
IGL01349:Kcnh6 APN 11 106023917 missense possibly damaging 0.82
IGL01529:Kcnh6 APN 11 106020696 missense probably benign 0.07
IGL01555:Kcnh6 APN 11 106017619 missense probably damaging 0.99
IGL01596:Kcnh6 APN 11 106026746 missense probably benign 0.02
IGL01808:Kcnh6 APN 11 106023927 splice site probably benign
IGL02001:Kcnh6 APN 11 106027549 splice site probably benign
IGL02131:Kcnh6 APN 11 106020175 missense probably damaging 1.00
IGL02254:Kcnh6 APN 11 106020707 missense probably damaging 1.00
IGL02413:Kcnh6 APN 11 106027634 missense possibly damaging 0.77
R0089:Kcnh6 UTSW 11 106009022 missense probably benign 0.31
R1914:Kcnh6 UTSW 11 106017444 nonsense probably null
R1915:Kcnh6 UTSW 11 106017444 nonsense probably null
R2265:Kcnh6 UTSW 11 106033817 missense probably benign
R2325:Kcnh6 UTSW 11 106033835 missense probably benign 0.00
R4449:Kcnh6 UTSW 11 106018936 missense probably damaging 0.99
R4548:Kcnh6 UTSW 11 106009049 missense probably damaging 1.00
R5095:Kcnh6 UTSW 11 106017254 missense possibly damaging 0.92
R5166:Kcnh6 UTSW 11 106020319 missense possibly damaging 0.67
R5358:Kcnh6 UTSW 11 106027591 missense possibly damaging 0.93
R5445:Kcnh6 UTSW 11 106023859 missense probably damaging 1.00
R5652:Kcnh6 UTSW 11 106008985 missense probably damaging 1.00
R5708:Kcnh6 UTSW 11 106020256 missense probably benign 0.04
R5742:Kcnh6 UTSW 11 106009142 missense probably benign 0.32
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6150:Kcnh6 UTSW 11 106020731 missense possibly damaging 0.83
R6827:Kcnh6 UTSW 11 106009099 missense probably benign 0.05
R7172:Kcnh6 UTSW 11 106020274 missense possibly damaging 0.86
R7359:Kcnh6 UTSW 11 106018963 missense possibly damaging 0.46
R7542:Kcnh6 UTSW 11 106014561 missense possibly damaging 0.68
R7571:Kcnh6 UTSW 11 106017416 missense probably benign 0.01
R7580:Kcnh6 UTSW 11 106017548 missense probably damaging 1.00
R7703:Kcnh6 UTSW 11 106023877 missense probably benign
R7726:Kcnh6 UTSW 11 106017575 missense probably benign 0.04
R7837:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7854:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
R7920:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7937:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
X0065:Kcnh6 UTSW 11 106025795 missense probably benign
Z1088:Kcnh6 UTSW 11 106009048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTGACAGTTCTCCTCC -3'
(R):5'- CCACCTCGTCATTAGTGTTGAC -3'

Sequencing Primer
(F):5'- ATAGACCGGTCTTCCTAGCAGTG -3'
(R):5'- GACGTAGGTGGTTCGGAAG -3'
Posted On2019-09-13