Incidental Mutation 'R7329:Adgrb1'
ID569147
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74539245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 330 (T330K)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: T330K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186360
AA Change: T330K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187485
AA Change: T330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: T330K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
Bunting UTSW 15 74543701 missense probably null 0.94
BB005:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
BB015:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
PIT4520001:Adgrb1 UTSW 15 74541659 missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74574110 missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74569881 missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74569948 missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74569884 missense probably benign
R7283:Adgrb1 UTSW 15 74580663 missense possibly damaging 0.94
R7616:Adgrb1 UTSW 15 74548569 missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74543638 missense possibly damaging 0.95
R7928:Adgrb1 UTSW 15 74538321 missense probably damaging 1.00
R8152:Adgrb1 UTSW 15 74541611 missense probably benign 0.00
R8152:Adgrb1 UTSW 15 74545000 missense probably damaging 0.98
R8198:Adgrb1 UTSW 15 74539245 missense probably damaging 0.99
R8485:Adgrb1 UTSW 15 74548304 missense probably damaging 1.00
R8528:Adgrb1 UTSW 15 74575851 missense possibly damaging 0.51
R8534:Adgrb1 UTSW 15 74543508 missense probably damaging 0.97
R8865:Adgrb1 UTSW 15 74543658 missense possibly damaging 0.75
Z1177:Adgrb1 UTSW 15 74541676 missense probably damaging 1.00
Z1177:Adgrb1 UTSW 15 74547683 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCAGGGAACATGCTCTG -3'
(R):5'- TCTGGTACAAACTAGATGAGATGC -3'

Sequencing Primer
(F):5'- TCTGCATGGGGCTGTCC -3'
(R):5'- ACTAGATGAGATGCATTATAGCCG -3'
Posted On2019-09-13