Incidental Mutation 'R7329:Cyb561a3'
ID569154
Institutional Source Beutler Lab
Gene Symbol Cyb561a3
Ensembl Gene ENSMUSG00000034445
Gene Namecytochrome b561 family, member A3
SynonymsCybasc3, 2310004G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10577454-10588548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10587904 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 211 (G211C)
Ref Sequence ENSEMBL: ENSMUSP00000130680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678] [ENSMUST00000168445]
Predicted Effect probably benign
Transcript: ENSMUST00000037678
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168445
AA Change: G211C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130680
Gene: ENSMUSG00000034445
AA Change: G211C

DomainStartEndE-ValueType
B561 46 175 1.47e-40 SMART
low complexity region 205 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Cyb561a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cyb561a3 APN 19 10585246 missense probably damaging 1.00
IGL01418:Cyb561a3 APN 19 10585246 missense probably damaging 1.00
IGL03193:Cyb561a3 APN 19 10582400 missense probably benign
R0562:Cyb561a3 UTSW 19 10586710 missense probably benign
R1829:Cyb561a3 UTSW 19 10582393 nonsense probably null
R2327:Cyb561a3 UTSW 19 10586802 missense probably benign 0.01
R3817:Cyb561a3 UTSW 19 10582364 missense possibly damaging 0.53
R3874:Cyb561a3 UTSW 19 10585371 missense probably benign 0.06
R5260:Cyb561a3 UTSW 19 10587866 missense possibly damaging 0.94
R6009:Cyb561a3 UTSW 19 10586808 missense possibly damaging 0.93
R6861:Cyb561a3 UTSW 19 10585337 missense probably damaging 1.00
R7436:Cyb561a3 UTSW 19 10582332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAGTTCTTGCCTGTTGTTATG -3'
(R):5'- TTGGCTTCCCACCTGGCTATAG -3'

Sequencing Primer
(F):5'- AGTGACTTGGTATGTTAATTCCAGG -3'
(R):5'- CACCTGGCTATAGGGTCAATC -3'
Posted On2019-09-13