Incidental Mutation 'R7330:Olfr1161'
ID569160
Institutional Source Beutler Lab
Gene Symbol Olfr1161
Ensembl Gene ENSMUSG00000045150
Gene Nameolfactory receptor 1161
SynonymsMOR174-2, GA_x6K02T2Q125-49516664-49517629
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88022774-88028252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88024921 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 66 (H66Q)
Ref Sequence ENSEMBL: ENSMUSP00000150251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054845] [ENSMUST00000214438] [ENSMUST00000217006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054845
AA Change: H66Q

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060977
Gene: ENSMUSG00000045150
AA Change: H66Q

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.8e-52 PFAM
Pfam:7tm_1 42 291 9e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214438
AA Change: H66Q

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217006
AA Change: H66Q

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Olfr1161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr1161 APN 2 88025003 missense probably benign 0.23
IGL01564:Olfr1161 APN 2 88025304 missense probably benign 0.00
IGL01588:Olfr1161 APN 2 88025073 missense probably benign
R0268:Olfr1161 UTSW 2 88025468 missense probably damaging 0.99
R1587:Olfr1161 UTSW 2 88025133 missense probably damaging 1.00
R1995:Olfr1161 UTSW 2 88025672 missense probably benign 0.06
R2249:Olfr1161 UTSW 2 88025363 missense probably damaging 0.98
R3813:Olfr1161 UTSW 2 88024761 missense probably damaging 1.00
R4473:Olfr1161 UTSW 2 88025120 missense probably damaging 1.00
R4772:Olfr1161 UTSW 2 88024863 missense probably damaging 0.99
R4787:Olfr1161 UTSW 2 88024860 missense possibly damaging 0.79
R4870:Olfr1161 UTSW 2 88025460 missense probably damaging 1.00
R5260:Olfr1161 UTSW 2 88025474 missense probably benign 0.02
R5896:Olfr1161 UTSW 2 88025121 missense probably damaging 0.98
R6262:Olfr1161 UTSW 2 88025394 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTGGGGCCATGTTCATC -3'
(R):5'- AGTTTCTGAGACATGGCTACTGTG -3'

Sequencing Primer
(F):5'- GGGCCATGTTCATCCTATTGAGC -3'
(R):5'- GTCTGCAGATGGCCACAAATCTG -3'
Posted On2019-09-13