Incidental Mutation 'R7330:Epha2'
ID569164
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141308453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably benign
Transcript: ENSMUST00000006614
AA Change: S67T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: S67T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 intron probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCCTGTAGAATGAAGGC -3'
(R):5'- GTGCCATAGTCCACATCTGAC -3'

Sequencing Primer
(F):5'- TCCCTCAGGACACAGTGAGTTTG -3'
(R):5'- CACATCTGACTCTGCATAGTAGAGG -3'
Posted On2019-09-13