Incidental Mutation 'R7330:Lat2'
ID569168
Institutional Source Beutler Lab
Gene Symbol Lat2
Ensembl Gene ENSMUSG00000040751
Gene Namelinker for activation of T cells family, member 2
SynonymsWbscr15, Wbscr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134600022-134615025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134606787 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 58 (T58S)
Ref Sequence ENSEMBL: ENSMUSP00000046900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023867] [ENSMUST00000036362] [ENSMUST00000077636] [ENSMUST00000200737] [ENSMUST00000200998] [ENSMUST00000202085]
Predicted Effect probably benign
Transcript: ENSMUST00000023867
SMART Domains Protein: ENSMUSP00000023867
Gene: ENSMUSG00000023104

DomainStartEndE-ValueType
AAA 63 189 9.42e-13 SMART
Pfam:Rep_fac_C 253 338 3.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036362
AA Change: T58S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046900
Gene: ENSMUSG00000040751
AA Change: T58S

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077636
AA Change: T58S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076824
Gene: ENSMUSG00000040751
AA Change: T58S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200737
AA Change: T58S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143998
Gene: ENSMUSG00000040751
AA Change: T58S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 114 9.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200998
AA Change: T58S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143977
Gene: ENSMUSG00000040751
AA Change: T58S

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201632
Predicted Effect possibly damaging
Transcript: ENSMUST00000202085
AA Change: T58S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144611
Gene: ENSMUSG00000040751
AA Change: T58S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 116 7.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal mast cell physiology and increased anti-nuclear antigen antibody level. Mice homozygous for another null allele show abnormal mast cell physiology, hyperactivated T cells, higher cytokine production, spleenhyperplasia and increased autoantibody level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Lat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lat2 APN 5 134606776 critical splice donor site probably null
IGL01897:Lat2 APN 5 134606627 splice site probably benign
IGL02869:Lat2 APN 5 134608173 missense probably damaging 1.00
IGL03018:Lat2 APN 5 134602591 missense probably damaging 0.97
R0735:Lat2 UTSW 5 134606783 missense probably damaging 1.00
R1739:Lat2 UTSW 5 134606369 missense possibly damaging 0.93
R2257:Lat2 UTSW 5 134602627 missense probably damaging 1.00
R2866:Lat2 UTSW 5 134605944 missense probably damaging 0.99
R4675:Lat2 UTSW 5 134606057 missense probably damaging 0.99
R5008:Lat2 UTSW 5 134603137 missense probably benign 0.02
R6014:Lat2 UTSW 5 134603454 missense probably damaging 1.00
R6422:Lat2 UTSW 5 134603161 missense probably benign 0.00
R7512:Lat2 UTSW 5 134605944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCACTTTGGAGAGAAGC -3'
(R):5'- CATGGCTAAAGCTTGCTCACTG -3'

Sequencing Primer
(F):5'- CAAGGATGGGGTATTGGCTAGGC -3'
(R):5'- GCACTGGCTTGCATAGAACTTAC -3'
Posted On2019-09-13