Incidental Mutation 'R7330:Itpr1'
ID 569172
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission 045423-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R7330 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108415292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1742 (R1742H)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203262] [ENSMUST00000203615]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: R1742H

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: R1742H

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203262
AA Change: R128H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145177
Gene: ENSMUSG00000030102
AA Change: R128H

DomainStartEndE-ValueType
low complexity region 144 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: R1741H

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: R1741H

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 118,977,450 (GRCm39) T411A possibly damaging Het
Ace A G 11: 105,876,887 (GRCm39) H1123R probably damaging Het
Acot12 T A 13: 91,889,651 (GRCm39) M1K probably null Het
Actr2 A T 11: 20,022,544 (GRCm39) M309K probably damaging Het
Ahsa2 G T 11: 23,440,558 (GRCm39) T279K probably benign Het
Ak8 A G 2: 28,702,947 (GRCm39) Y437C possibly damaging Het
Atp1a3 T A 7: 24,700,577 (GRCm39) K5* probably null Het
Bbs2 T A 8: 94,814,033 (GRCm39) E195V possibly damaging Het
C4b T A 17: 34,949,446 (GRCm39) Y1505F probably damaging Het
Camkk1 C G 11: 72,917,873 (GRCm39) N147K probably damaging Het
Cdh18 G A 15: 23,227,036 (GRCm39) V166I possibly damaging Het
Cep135 T A 5: 76,754,592 (GRCm39) C356* probably null Het
Cilp A T 9: 65,187,527 (GRCm39) R1207S probably benign Het
Clcnkb A G 4: 141,137,923 (GRCm39) I291T possibly damaging Het
Clrn3 G T 7: 135,130,198 (GRCm39) S12Y probably damaging Het
Clstn2 G T 9: 97,343,422 (GRCm39) A675D probably benign Het
Cpvl A G 6: 53,951,744 (GRCm39) I13T probably benign Het
Cyp2c68 A G 19: 39,677,634 (GRCm39) I452T probably damaging Het
Dhh A G 15: 98,792,291 (GRCm39) V239A probably damaging Het
Edar T G 10: 58,446,376 (GRCm39) H183P probably damaging Het
Epha2 T A 4: 141,035,764 (GRCm39) S67T probably benign Het
Gapdh A G 6: 125,139,900 (GRCm39) L168P probably benign Het
Grm4 C T 17: 27,653,798 (GRCm39) W717* probably null Het
Gtf3c1 T C 7: 125,303,055 (GRCm39) I127V probably benign Het
Igkv4-72 C T 6: 69,204,087 (GRCm39) A35T probably damaging Het
Il6st T A 13: 112,630,185 (GRCm39) S344T probably benign Het
Ip6k1 A G 9: 107,922,452 (GRCm39) D168G possibly damaging Het
Lat2 T A 5: 134,635,641 (GRCm39) T58S probably damaging Het
Limk2 T C 11: 3,296,311 (GRCm39) K566E probably benign Het
Lonp2 C A 8: 87,358,022 (GRCm39) T81K probably damaging Het
Mdn1 C A 4: 32,723,685 (GRCm39) N2540K probably benign Het
Myt1l T A 12: 29,901,553 (GRCm39) D769E unknown Het
Neb C T 2: 52,079,715 (GRCm39) V5780M possibly damaging Het
Or1j18 T A 2: 36,625,057 (GRCm39) C241* probably null Het
Or5d35 C A 2: 87,855,265 (GRCm39) H66Q possibly damaging Het
Or6c8b C T 10: 128,882,333 (GRCm39) V200M probably damaging Het
Or7g25 T A 9: 19,160,567 (GRCm39) I43F probably benign Het
Pcdhga12 T C 18: 37,901,439 (GRCm39) V757A probably damaging Het
Prpf31 A G 7: 3,642,854 (GRCm39) T448A probably damaging Het
Rbm6 A T 9: 107,668,244 (GRCm39) M694K possibly damaging Het
Ropn1l T C 15: 31,451,349 (GRCm39) Y45C Het
Selenbp1 T A 3: 94,847,021 (GRCm39) D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,453,486 (GRCm39) probably benign Het
Spef1 G A 2: 131,014,653 (GRCm39) R90W probably damaging Het
Sspo A G 6: 48,452,396 (GRCm39) S2787G probably benign Het
Stox2 A G 8: 47,645,271 (GRCm39) S730P possibly damaging Het
Syne1 T C 10: 5,078,434 (GRCm39) N997S probably benign Het
Tipin A G 9: 64,195,508 (GRCm39) D38G probably benign Het
Tshz1 T A 18: 84,032,956 (GRCm39) K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ttll3 A AAGTAC 6: 113,376,125 (GRCm39) probably null Het
Ttn C T 2: 76,747,355 (GRCm39) V4565I probably benign Het
Ubr7 A G 12: 102,741,971 (GRCm39) I402V probably damaging Het
Ucn3 A T 13: 3,991,216 (GRCm39) N145K possibly damaging Het
Utp18 A T 11: 93,772,899 (GRCm39) probably null Het
Utp20 GAA GA 10: 88,623,424 (GRCm39) probably null Het
Vmn1r189 A G 13: 22,286,711 (GRCm39) I42T possibly damaging Het
Vmn2r91 T C 17: 18,326,429 (GRCm39) M238T probably damaging Het
Washc5 G T 15: 59,205,516 (GRCm39) A1125D probably benign Het
Wsb2 A G 5: 117,508,827 (GRCm39) E87G probably damaging Het
Zfat G A 15: 68,084,600 (GRCm39) P97L probably benign Het
Zfp87 T G 13: 74,523,153 (GRCm39) T22P probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,366,498 (GRCm39) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5929:Itpr1 UTSW 6 108,400,297 (GRCm39) missense probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6838:Itpr1 UTSW 6 108,448,152 (GRCm39) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,378,311 (GRCm39) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAGAAAATATTGGAAGTTGAC -3'
(R):5'- TTGTCAAGCAAAAGCAGACAGC -3'

Sequencing Primer
(F):5'- AGTTGACTTCAAAGTTTCTTAAATGC -3'
(R):5'- AGACAGCTCCTTGTGACATG -3'
Posted On 2019-09-13