Incidental Mutation 'R7330:Itpr1'
ID569172
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108438331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1742 (R1742H)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203262] [ENSMUST00000203615]
PDB Structure
Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: R1742H

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: R1742H

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203262
AA Change: R128H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145177
Gene: ENSMUSG00000030102
AA Change: R128H

DomainStartEndE-ValueType
low complexity region 144 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: R1741H

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: R1741H

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7502:Itpr1 UTSW 6 108383678 missense probably benign 0.00
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7937:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAGAAAATATTGGAAGTTGAC -3'
(R):5'- TTGTCAAGCAAAAGCAGACAGC -3'

Sequencing Primer
(F):5'- AGTTGACTTCAAAGTTTCTTAAATGC -3'
(R):5'- AGACAGCTCCTTGTGACATG -3'
Posted On2019-09-13