Incidental Mutation 'R0639:Adrb3'
ID 56919
Institutional Source Beutler Lab
Gene Symbol Adrb3
Ensembl Gene ENSMUSG00000031489
Gene Name adrenergic receptor, beta 3
Synonyms Beta-3 AR, beta 3-AR, Beta-3 adrenoceptor, Adrb-3, beta3-adrenergic receptor
MMRRC Submission 038828-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R0639 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 27715804-27720833 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27718293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 52 (N52S)
Ref Sequence ENSEMBL: ENSMUSP00000113006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081438] [ENSMUST00000117565] [ENSMUST00000121838] [ENSMUST00000209299]
AlphaFold P25962
Predicted Effect probably damaging
Transcript: ENSMUST00000081438
AA Change: N52S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080162
Gene: ENSMUSG00000031489
AA Change: N52S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117565
AA Change: N52S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113732
Gene: ENSMUSG00000031489
AA Change: N52S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.8e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.4e-14 PFAM
Pfam:7tm_1 51 343 4.9e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121838
AA Change: N52S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113006
Gene: ENSMUSG00000031489
AA Change: N52S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 43 240 1.1e-6 PFAM
Pfam:7TM_GPCR_Srsx 45 357 2.3e-14 PFAM
Pfam:7tm_1 51 343 9.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211346
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for targeted null mutations develop greater adiposity, especially on a high-fat diet, and are unresponsive to the beta3-adrenergic receptor agonist, CL316,243. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 46,043,999 (GRCm39) W86* probably null Het
Acadl T C 1: 66,896,567 (GRCm39) H75R probably benign Het
Adamtsl1 T C 4: 86,195,380 (GRCm39) F599S probably damaging Het
Agbl3 T A 6: 34,776,640 (GRCm39) L377Q probably damaging Het
Akap9 T C 5: 4,110,318 (GRCm39) L3007P probably damaging Het
Amer3 T A 1: 34,626,902 (GRCm39) Y380* probably null Het
Ankrd13d A T 19: 4,323,047 (GRCm39) probably null Het
Ap4m1 T A 5: 138,174,501 (GRCm39) C235S probably benign Het
Arhgap29 T C 3: 121,801,290 (GRCm39) F675S probably damaging Het
Asah2 C A 19: 31,986,039 (GRCm39) V544F probably damaging Het
Ash2l A G 8: 26,313,319 (GRCm39) I389T possibly damaging Het
Bend5 T C 4: 111,290,495 (GRCm39) S164P probably benign Het
Cacna1d A G 14: 29,893,251 (GRCm39) probably null Het
Cdc25b A G 2: 131,039,182 (GRCm39) N516D probably benign Het
Cdc27 A G 11: 104,422,560 (GRCm39) Y125H probably damaging Het
Cdk5r2 C T 1: 74,894,995 (GRCm39) L247F probably damaging Het
Cenpf C A 1: 189,390,259 (GRCm39) G1191V probably benign Het
Cops4 C T 5: 100,685,326 (GRCm39) T293I possibly damaging Het
Csmd3 A G 15: 47,777,336 (GRCm39) L1294P probably damaging Het
Dclre1a T C 19: 56,526,872 (GRCm39) Y848C probably damaging Het
Disp2 A T 2: 118,621,325 (GRCm39) I686F possibly damaging Het
Dnah6 T A 6: 72,999,395 (GRCm39) Y4012F probably benign Het
Dnajc11 C G 4: 152,054,393 (GRCm39) R200G probably damaging Het
Dnhd1 A T 7: 105,345,671 (GRCm39) D2272V possibly damaging Het
Elane A C 10: 79,722,183 (GRCm39) R5S possibly damaging Het
Entpd7 G A 19: 43,679,533 (GRCm39) V29M probably benign Het
Fanca A G 8: 124,016,098 (GRCm39) probably null Het
Fgl1 G T 8: 41,644,661 (GRCm39) T281K probably benign Het
Flii T C 11: 60,613,823 (GRCm39) probably null Het
Foxn1 T C 11: 78,261,970 (GRCm39) D133G possibly damaging Het
Fzd7 T A 1: 59,523,719 (GRCm39) M534K probably damaging Het
Galnt5 A G 2: 57,889,407 (GRCm39) T336A probably benign Het
Gli3 G A 13: 15,899,300 (GRCm39) D896N probably damaging Het
Gsx1 G T 5: 147,126,756 (GRCm39) W193L probably damaging Het
Gtpbp3 A T 8: 71,945,379 (GRCm39) I485F probably damaging Het
H2-M11 A G 17: 36,858,283 (GRCm39) T26A probably benign Het
Igfbp7 T C 5: 77,499,827 (GRCm39) D243G probably damaging Het
Il31ra A T 13: 112,662,377 (GRCm39) D477E possibly damaging Het
Inmt A C 6: 55,148,212 (GRCm39) V139G probably damaging Het
Inpp5j T A 11: 3,451,147 (GRCm39) M501L probably benign Het
Itsn2 T C 12: 4,762,556 (GRCm39) F1579L probably damaging Het
Kat2b C A 17: 53,874,566 (GRCm39) A70E probably benign Het
Klhl20 T C 1: 160,921,281 (GRCm39) E58G probably damaging Het
Krt79 A T 15: 101,839,983 (GRCm39) Y337* probably null Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Letm1 T C 5: 33,926,770 (GRCm39) I176V possibly damaging Het
Lingo3 C A 10: 80,671,618 (GRCm39) R104L probably benign Het
Lrig3 T G 10: 125,846,090 (GRCm39) C840G probably damaging Het
Lrrc9 A G 12: 72,533,062 (GRCm39) N977S probably damaging Het
Lrrk2 T A 15: 91,657,199 (GRCm39) M1831K probably benign Het
Mn1 A T 5: 111,567,182 (GRCm39) D384V probably damaging Het
Morc3 C A 16: 93,650,738 (GRCm39) H319Q probably damaging Het
Morn1 T C 4: 155,173,960 (GRCm39) F56L possibly damaging Het
Mrpl53 G T 6: 83,086,392 (GRCm39) V64L probably damaging Het
Myo15a T A 11: 60,370,162 (GRCm39) V974D probably benign Het
Neb A G 2: 52,146,136 (GRCm39) V2947A possibly damaging Het
Nfasc A C 1: 132,531,554 (GRCm39) N737K probably damaging Het
Nlk T C 11: 78,463,103 (GRCm39) D464G possibly damaging Het
Nlrc4 C T 17: 74,733,958 (GRCm39) R985K probably benign Het
Nsun6 T C 2: 15,001,147 (GRCm39) K470E probably benign Het
Nup85 T G 11: 115,455,357 (GRCm39) M1R probably null Het
Or8b39 G A 9: 37,996,666 (GRCm39) C178Y probably damaging Het
Otop1 T C 5: 38,445,292 (GRCm39) V150A possibly damaging Het
Pclo C T 5: 14,731,763 (GRCm39) R296* probably null Het
Pdzd2 A T 15: 12,458,144 (GRCm39) C240S possibly damaging Het
Plekhg5 A G 4: 152,198,577 (GRCm39) T922A probably benign Het
Plekhm2 A C 4: 141,369,381 (GRCm39) L101R probably damaging Het
Plscr3 T A 11: 69,738,820 (GRCm39) C161S probably benign Het
Prr14l C T 5: 32,986,259 (GRCm39) D1079N probably benign Het
Ptpru A T 4: 131,498,490 (GRCm39) V1377E possibly damaging Het
Rab37 C A 11: 115,049,528 (GRCm39) D112E probably benign Het
Raet1e T A 10: 22,050,274 (GRCm39) I19N probably damaging Het
Rassf5 T C 1: 131,172,803 (GRCm39) Y22C probably damaging Het
Rp1 T C 1: 4,416,721 (GRCm39) T1464A probably benign Het
Safb T A 17: 56,908,092 (GRCm39) probably benign Het
Scarf2 A G 16: 17,624,369 (GRCm39) probably null Het
Scart2 A G 7: 139,827,872 (GRCm39) N27D probably benign Het
Sh3d19 T C 3: 86,014,280 (GRCm39) S415P probably benign Het
Slc26a9 T A 1: 131,691,542 (GRCm39) L595Q probably damaging Het
Slc4a8 T C 15: 100,694,431 (GRCm39) Y470H probably damaging Het
Slitrk3 T C 3: 72,956,982 (GRCm39) N597D probably benign Het
Spata31 T A 13: 65,070,027 (GRCm39) V725E probably benign Het
Spink12 T A 18: 44,240,831 (GRCm39) C72* probably null Het
Spink5 T A 18: 44,146,042 (GRCm39) probably null Het
Stk40 C A 4: 126,012,125 (GRCm39) S9* probably null Het
Sypl1 A T 12: 33,015,420 (GRCm39) T40S probably damaging Het
Tbc1d8 C T 1: 39,430,290 (GRCm39) E438K probably benign Het
Tdrd7 A G 4: 45,989,102 (GRCm39) T111A probably benign Het
Tg A T 15: 66,613,333 (GRCm39) probably null Het
Tlr5 T A 1: 182,801,454 (GRCm39) W253R probably damaging Het
Tmprss11c C T 5: 86,383,328 (GRCm39) C353Y probably damaging Het
Tnfrsf8 T A 4: 145,014,597 (GRCm39) M271L probably benign Het
Toe1 T C 4: 116,663,947 (GRCm39) N21S probably benign Het
Tpp2 T C 1: 44,014,607 (GRCm39) F649L probably benign Het
Ttll1 G A 15: 83,386,426 (GRCm39) Q60* probably null Het
Vcp C T 4: 42,982,565 (GRCm39) R709Q probably benign Het
Vmn1r119 T A 7: 20,745,593 (GRCm39) H263L possibly damaging Het
Vmn1r195 C A 13: 22,463,111 (GRCm39) Q194K probably damaging Het
Vmn1r33 T C 6: 66,588,783 (GRCm39) Y257C probably damaging Het
Vmn2r15 A G 5: 109,440,881 (GRCm39) F326L probably benign Het
Wbp11 A T 6: 136,793,108 (GRCm39) probably benign Het
Wwp2 T G 8: 108,244,578 (GRCm39) V250G probably benign Het
Xpnpep3 T C 15: 81,315,038 (GRCm39) V246A probably benign Het
Zcchc14 G A 8: 122,332,188 (GRCm39) R419* probably null Het
Other mutations in Adrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0786:Adrb3 UTSW 8 27,716,880 (GRCm39) unclassified probably benign
R1370:Adrb3 UTSW 8 27,717,798 (GRCm39) splice site probably null
R1449:Adrb3 UTSW 8 27,717,415 (GRCm39) missense probably damaging 1.00
R1874:Adrb3 UTSW 8 27,717,591 (GRCm39) missense probably damaging 1.00
R3426:Adrb3 UTSW 8 27,718,209 (GRCm39) missense probably damaging 1.00
R3428:Adrb3 UTSW 8 27,718,209 (GRCm39) missense probably damaging 1.00
R4941:Adrb3 UTSW 8 27,717,450 (GRCm39) missense probably damaging 1.00
R4989:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R4994:Adrb3 UTSW 8 27,717,855 (GRCm39) splice site probably null
R5133:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R5134:Adrb3 UTSW 8 27,717,798 (GRCm39) missense probably damaging 1.00
R5162:Adrb3 UTSW 8 27,717,348 (GRCm39) missense probably benign 0.25
R5342:Adrb3 UTSW 8 27,716,809 (GRCm39) nonsense probably null
R5656:Adrb3 UTSW 8 27,717,405 (GRCm39) missense probably damaging 0.99
R8159:Adrb3 UTSW 8 27,718,099 (GRCm39) missense probably benign 0.06
R9020:Adrb3 UTSW 8 27,717,947 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTCGCAACCAGTTTCGCC -3'
(R):5'- GCTGTTCCTTTAAAAGCAGCCACTC -3'

Sequencing Primer
(F):5'- ACCAGTTTCGCCCAAGG -3'
(R):5'- TTACCCCAGCAATTAGGGAAG -3'
Posted On 2013-07-11