Incidental Mutation 'R7330:Actr2'
ID569195
Institutional Source Beutler Lab
Gene Symbol Actr2
Ensembl Gene ENSMUSG00000020152
Gene NameARP2 actin-related protein 2
Synonyms4921510D23Rik, D6Ertd746e, Arp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location20062304-20112913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20072544 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 309 (M309K)
Ref Sequence ENSEMBL: ENSMUSP00000000137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000137]
Predicted Effect probably damaging
Transcript: ENSMUST00000000137
AA Change: M309K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000137
Gene: ENSMUSG00000020152
AA Change: M309K

DomainStartEndE-ValueType
ACTIN 6 390 2.78e-208 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for this mutation exhibit modifies lethality associated with F5 null Tfpi heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Actr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Actr2 APN 11 20094370 missense probably benign 0.03
IGL00164:Actr2 APN 11 20080015 splice site probably benign
IGL00566:Actr2 APN 11 20072487 missense possibly damaging 0.92
IGL00822:Actr2 APN 11 20094367 missense probably damaging 1.00
IGL02993:Actr2 APN 11 20072514 missense probably damaging 1.00
IGL03330:Actr2 APN 11 20091330 missense probably benign 0.01
R0092:Actr2 UTSW 11 20094308 missense probably benign 0.00
R0129:Actr2 UTSW 11 20100939 splice site probably benign
R0513:Actr2 UTSW 11 20080124 missense probably damaging 1.00
R0848:Actr2 UTSW 11 20072584 missense probably benign 0.02
R0863:Actr2 UTSW 11 20080760 missense probably benign 0.00
R5175:Actr2 UTSW 11 20080114 missense probably benign 0.25
R5364:Actr2 UTSW 11 20100797 intron probably benign
R6544:Actr2 UTSW 11 20100933 missense probably damaging 1.00
X0021:Actr2 UTSW 11 20080702 missense probably damaging 0.99
X0066:Actr2 UTSW 11 20080065 missense probably benign 0.00
X0066:Actr2 UTSW 11 20080066 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCCTCTGGTGGTTGTCAAG -3'
(R):5'- CAGTCCTAATCTAGCAGAGGC -3'

Sequencing Primer
(F):5'- GTGGTTGTCAAGATCCACAAGCTAC -3'
(R):5'- GAGGCTTGAGCTTCTGATCTTCC -3'
Posted On2019-09-13