Incidental Mutation 'R7330:Vmn2r91'
ID569213
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7330 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18106167 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 238 (M238T)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably damaging
Transcript: ENSMUST00000172359
AA Change: M238T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: M238T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Tshz1 T A 18: 84,014,831 K484M probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTCTCTTGAGTGACCATAGTC -3'
(R):5'- AGGCTTCCATGGAATAAGTCTAAC -3'

Sequencing Primer
(F):5'- GTCAGTATCCTTCTCTCTACCAAATG -3'
(R):5'- GTTCAATGTTCATGACCCAGAC -3'
Posted On2019-09-13