Incidental Mutation 'R7330:Tshz1'
ID 569217
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Name teashirt zinc finger family member 1
Synonyms Mtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7330 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 84011627-84086404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84014831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 484 (K484M)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
AlphaFold Q5DTH5
Predicted Effect probably damaging
Transcript: ENSMUST00000060303
AA Change: K484M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: K484M

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T C 9: 119,148,382 T411A possibly damaging Het
Ace A G 11: 105,986,061 H1123R probably damaging Het
Acot12 T A 13: 91,741,532 M1K probably null Het
Actr2 A T 11: 20,072,544 M309K probably damaging Het
Ahsa2 G T 11: 23,490,558 T279K probably benign Het
Ak8 A G 2: 28,812,935 Y437C possibly damaging Het
Atp1a3 T A 7: 25,001,152 K5* probably null Het
Bbs2 T A 8: 94,087,405 E195V possibly damaging Het
C4b T A 17: 34,730,472 Y1505F probably damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Cdh18 G A 15: 23,226,950 V166I possibly damaging Het
Cep135 T A 5: 76,606,745 C356* probably null Het
Cilp A T 9: 65,280,245 R1207S probably benign Het
Clcnkb A G 4: 141,410,612 I291T possibly damaging Het
Clrn3 G T 7: 135,528,469 S12Y probably damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cpvl A G 6: 53,974,759 I13T probably benign Het
Cyp2c68 A G 19: 39,689,190 I452T probably damaging Het
Dhh A G 15: 98,894,410 V239A probably damaging Het
Edar T G 10: 58,610,554 H183P probably damaging Het
Epha2 T A 4: 141,308,453 S67T probably benign Het
Gapdh A G 6: 125,162,937 L168P probably benign Het
Grm4 C T 17: 27,434,824 W717* probably null Het
Gtf3c1 T C 7: 125,703,883 I127V probably benign Het
Igkv4-72 C T 6: 69,227,103 A35T probably damaging Het
Il6st T A 13: 112,493,651 S344T probably benign Het
Ip6k1 A G 9: 108,045,253 D168G possibly damaging Het
Itpr1 G A 6: 108,438,331 R1742H probably benign Het
Lat2 T A 5: 134,606,787 T58S probably damaging Het
Limk2 T C 11: 3,346,311 K566E probably benign Het
Lonp2 C A 8: 86,631,394 T81K probably damaging Het
Mdn1 C A 4: 32,723,685 N2540K probably benign Het
Myt1l T A 12: 29,851,554 D769E unknown Het
Neb C T 2: 52,189,703 V5780M possibly damaging Het
Olfr1161 C A 2: 88,024,921 H66Q possibly damaging Het
Olfr347 T A 2: 36,735,045 C241* probably null Het
Olfr765 C T 10: 129,046,464 V200M probably damaging Het
Olfr843 T A 9: 19,249,271 I43F probably benign Het
Pcdhga12 T C 18: 37,768,386 V757A probably damaging Het
Prpf31 A G 7: 3,639,855 T448A probably damaging Het
Rbm6 A T 9: 107,791,045 M694K possibly damaging Het
Ropn1l T C 15: 31,451,203 Y45C Het
Selenbp1 T A 3: 94,939,710 D182E probably benign Het
Son TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC 16: 91,656,598 probably benign Het
Spef1 G A 2: 131,172,733 R90W probably damaging Het
Sspo A G 6: 48,475,462 S2787G probably benign Het
Stox2 A G 8: 47,192,236 S730P possibly damaging Het
Syne1 T C 10: 5,128,434 N997S probably benign Het
Tipin A G 9: 64,288,226 D38G probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Ttn C T 2: 76,917,011 V4565I probably benign Het
Ubr7 A G 12: 102,775,712 I402V probably damaging Het
Ucn3 A T 13: 3,941,216 N145K possibly damaging Het
Utp18 A T 11: 93,882,073 probably null Het
Utp20 GAA GA 10: 88,787,562 probably null Het
Vmn1r189 A G 13: 22,102,541 I42T possibly damaging Het
Vmn2r91 T C 17: 18,106,167 M238T probably damaging Het
Washc5 G T 15: 59,333,667 A1125D probably benign Het
Wsb2 A G 5: 117,370,762 E87G probably damaging Het
Zfat G A 15: 68,212,751 P97L probably benign Het
Zfp72 T G 13: 74,375,034 T22P probably damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R0943:Tshz1 UTSW 18 84015231 missense probably benign 0.04
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7941:Tshz1 UTSW 18 84015392 missense possibly damaging 0.91
R7947:Tshz1 UTSW 18 84015657 missense probably damaging 1.00
R8435:Tshz1 UTSW 18 84014024 missense probably damaging 1.00
R8750:Tshz1 UTSW 18 84015037 missense probably damaging 1.00
R8774:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R8774-TAIL:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R9029:Tshz1 UTSW 18 84013514 missense probably damaging 0.98
R9031:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R9573:Tshz1 UTSW 18 84014279 missense probably benign 0.45
R9584:Tshz1 UTSW 18 84014964 missense probably damaging 1.00
R9596:Tshz1 UTSW 18 84013779 missense possibly damaging 0.92
R9701:Tshz1 UTSW 18 84014454 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTGTCATCTAGGTCTTCC -3'
(R):5'- TGCATGGAATGTGGCAGCTC -3'

Sequencing Primer
(F):5'- AGGTCTTCCTCACGCAGGTAC -3'
(R):5'- GAATGTGGCAGCTCCCATGATAC -3'
Posted On 2019-09-13