Incidental Mutation 'R7331:Il1r2'
ID569219
Institutional Source Beutler Lab
Gene Symbol Il1r2
Ensembl Gene ENSMUSG00000026073
Gene Nameinterleukin 1 receptor, type II
SynonymsIL-1 receptor beta chain, CD121b, Il1r-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40074079-40125231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40123249 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 351 (T351A)
Ref Sequence ENSEMBL: ENSMUSP00000027243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027243] [ENSMUST00000195770]
Predicted Effect probably benign
Transcript: ENSMUST00000027243
AA Change: T351A

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027243
Gene: ENSMUSG00000026073
AA Change: T351A

DomainStartEndE-ValueType
IG 49 138 2.48e-8 SMART
IG 149 241 1.6e-2 SMART
IG 255 354 1.32e-3 SMART
transmembrane domain 359 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195770
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Il1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01945:Il1r2 APN 1 40102453 missense possibly damaging 0.66
IGL02673:Il1r2 APN 1 40115163 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0299:Il1r2 UTSW 1 40123149 nonsense probably null
R0499:Il1r2 UTSW 1 40123149 nonsense probably null
R0607:Il1r2 UTSW 1 40105455 missense probably benign 0.06
R1435:Il1r2 UTSW 1 40105299 missense probably damaging 0.99
R1925:Il1r2 UTSW 1 40115148 missense probably damaging 0.99
R2209:Il1r2 UTSW 1 40115138 missense probably benign 0.02
R2240:Il1r2 UTSW 1 40105470 missense probably damaging 1.00
R4997:Il1r2 UTSW 1 40121046 critical splice donor site probably null
R7273:Il1r2 UTSW 1 40112007 missense probably benign 0.06
R7401:Il1r2 UTSW 1 40123210 missense probably damaging 1.00
R7751:Il1r2 UTSW 1 40123211 missense probably damaging 1.00
R7841:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
R7924:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
X0010:Il1r2 UTSW 1 40117981 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCTCTGCATACATACATCATGC -3'
(R):5'- ACATGTATGTACAACGCTCTCTC -3'

Sequencing Primer
(F):5'- GCATACATACATCATGCTCTGAATAC -3'
(R):5'- GTATGTACAACGCTCTCTCTCTCAC -3'
Posted On2019-09-13