Mutagenetix > Incidental Mutation

Incidental Mutation 'R7331:Fbxo18'

569222

Institutional Source

Beutler Lab

Gene Symbol

Fbxo18

Ensembl Gene

ENSMUSG00000058594

Gene Name

F-box protein 18

Synonyms

Fbx18

MMRRC Submission

045424-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R7331 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11742573-11777582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11763986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 300 (C300S)

Ref Sequence

ENSEMBL: ENSMUSP00000071495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071564]

AlphaFold

Q8K2I9

Predicted Effect

probably benign
Transcript: ENSMUST00000071564
AA Change: C300S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: C300S

Domain	Start	End	E-Value	Type
FBOX	213	256	3.94e-3	SMART
Pfam:UvrD-helicase	626	692	8e-10	PFAM
Pfam:UvrD_C	862	935	1.7e-12	PFAM
Pfam:UvrD_C_2	867	931	1.6e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,183,609	H47L	possibly damaging	Het
Adgrf5	T	C	17: 43,437,593	S438P	probably damaging	Het
Atg16l2	C	A	7: 101,299,048	K96N	probably damaging	Het
Bglap2	A	T	3: 88,378,260	M35K	possibly damaging	Het
Btbd1	T	A	7: 81,815,972	I209L	probably damaging	Het
Cdc34	T	C	10: 79,685,312	Y148H	probably damaging	Het
Clcc1	A	G	3: 108,668,078	D157G	probably damaging	Het
Csmd2	A	T	4: 128,564,228		probably null	Het
Ctsj	G	A	13: 61,003,831	S90L	probably benign	Het
Cycs	A	G	6: 50,565,552	F37L	probably benign	Het
Dync2li1	T	A	17: 84,647,658	C248*	probably null	Het
Dzank1	A	T	2: 144,490,270	I382N	probably benign	Het
Enpp2	T	C	15: 54,875,670	I406V	probably damaging	Het
Ero1lb	A	G	13: 12,600,126	E282G	probably damaging	Het
Fam192a	T	A	8: 94,582,936	K143*	probably null	Het
Fastkd5	A	T	2: 130,615,727	N314K	possibly damaging	Het
Fchsd1	T	C	18: 37,968,770	I49V	possibly damaging	Het
Foxn1	A	G	11: 78,358,789	Y637H	probably damaging	Het
Gabarap	A	G	11: 69,994,472	E101G	possibly damaging	Het
Gm5580	G	A	6: 116,552,169	V336I	probably benign	Het
Gm7247	A	G	14: 51,364,335	R22G	probably damaging	Het
Gm7694	A	T	1: 170,301,611	D116E	possibly damaging	Het
Gm9508	A	G	10: 77,696,795	C147R	unknown	Het
Gpr152	A	G	19: 4,142,609	M50V	probably damaging	Het
Hunk	T	A	16: 90,472,562	N331K	possibly damaging	Het
Il1r2	A	G	1: 40,123,249	T351A	probably benign	Het
Iqub	A	G	6: 24,500,394	V287A	possibly damaging	Het
Lix1	A	T	17: 17,427,212	T47S	probably benign	Het
Lrp1b	A	T	2: 40,663,610		probably null	Het
Nup107	G	A	10: 117,770,198	T500I	probably damaging	Het
Phf21b	G	C	15: 84,791,094	R405G	probably benign	Het
Piezo2	A	G	18: 63,108,030	V709A	probably damaging	Het
Rfc1	T	C	5: 65,311,044	T109A	probably damaging	Het
Rpa1	A	G	11: 75,313,115	V302A	probably damaging	Het
Ryr2	A	G	13: 11,745,631	I1522T	probably benign	Het
Ryr3	C	A	2: 112,763,665	R2578L	possibly damaging	Het
Scgb2b18	C	T	7: 33,173,256	W41*	probably null	Het
Sdccag8	C	G	1: 176,868,290	Q387E	possibly damaging	Het
Slc25a17	G	A	15: 81,329,145	T119M	probably damaging	Het
Slc45a4	G	T	15: 73,605,640	Q16K	probably benign	Het
Slc4a1	G	A	11: 102,361,419		probably benign	Het
Slc7a14	T	C	3: 31,257,731	T47A	probably benign	Het
Stard6	A	G	18: 70,483,482	R71G	probably damaging	Het
Tecr	A	G	8: 83,571,935	V321A	probably damaging	Het
Ttc3	T	A	16: 94,394,359	F290L	probably benign	Het
Uqcc1	A	G	2: 155,911,811	V48A	probably benign	Het
V1rd19	T	A	7: 24,003,883	I258N	probably damaging	Het
Zar1	T	A	5: 72,580,312	E249V	possibly damaging	Het
Zfp101	T	C	17: 33,382,585	T66A	possibly damaging	Het
Zyx	A	G	6: 42,351,659	H230R	probably benign	Het

Other mutations in Fbxo18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Fbxo18	APN	2	11757523	nonsense	probably null
IGL02081:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02082:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02084:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02086:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02369:Fbxo18	APN	2	11747158	missense	possibly damaging	0.61
IGL02584:Fbxo18	APN	2	11759958	missense	probably benign	0.07
IGL03138:Fbxo18	UTSW	2	11749509	intron	probably benign
R0384:Fbxo18	UTSW	2	11749578	missense	probably damaging	1.00
R0479:Fbxo18	UTSW	2	11758419	missense	probably damaging	1.00
R0972:Fbxo18	UTSW	2	11764088	splice site	probably benign
R1420:Fbxo18	UTSW	2	11767682	missense	probably benign	0.01
R1827:Fbxo18	UTSW	2	11763888	missense	possibly damaging	0.88
R1832:Fbxo18	UTSW	2	11767400	missense	probably benign	0.08
R1960:Fbxo18	UTSW	2	11757528	missense	probably damaging	0.98
R2040:Fbxo18	UTSW	2	11769895	missense	possibly damaging	0.66
R2044:Fbxo18	UTSW	2	11762970	missense	possibly damaging	0.89
R2102:Fbxo18	UTSW	2	11758289	missense	probably benign	0.18
R3236:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R3975:Fbxo18	UTSW	2	11767210	missense	possibly damaging	0.72
R4504:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4505:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4507:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4799:Fbxo18	UTSW	2	11755747	missense	probably damaging	1.00
R4894:Fbxo18	UTSW	2	11762960	missense	probably damaging	1.00
R4994:Fbxo18	UTSW	2	11764230	missense	probably damaging	1.00
R5579:Fbxo18	UTSW	2	11748993	missense	probably damaging	0.97
R5801:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R6255:Fbxo18	UTSW	2	11748446	missense	probably benign	0.31
R7011:Fbxo18	UTSW	2	11762963	missense	probably damaging	1.00
R7177:Fbxo18	UTSW	2	11755711	missense	probably damaging	1.00
R7243:Fbxo18	UTSW	2	11751525	missense	probably benign	0.11
R7361:Fbxo18	UTSW	2	11747076	missense	probably damaging	1.00
R7460:Fbxo18	UTSW	2	11756685	missense	probably benign	0.38
R7541:Fbxo18	UTSW	2	11749537	missense	probably benign	0.05
R8000:Fbxo18	UTSW	2	11767289	missense	probably benign	0.21
R8010:Fbxo18	UTSW	2	11767632	missense	probably benign	0.15
R8056:Fbxo18	UTSW	2	11743630	missense	probably benign	0.01
R8517:Fbxo18	UTSW	2	11777430	critical splice donor site	probably null
R8686:Fbxo18	UTSW	2	11755658	missense	probably benign	0.00
R8883:Fbxo18	UTSW	2	11749111	missense	probably benign	0.21
R9093:Fbxo18	UTSW	2	11759990	missense	probably damaging	1.00
R9306:Fbxo18	UTSW	2	11767576	missense	probably benign	0.00
R9342:Fbxo18	UTSW	2	11749603	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GATTTCTCCATCATGCTACTCAGAG -3'
(R):5'- CTCGAGCCATGGCATAGAAAAG -3'

Sequencing Primer
(F):5'- CATCATGCTACTCAGAGATTCAATC -3'
(R):5'- AAAGGATTCGGACCTATGTGTGC -3'

Posted On

2019-09-13