Incidental Mutation 'R7331:Uqcc1'
ID569226
Institutional Source Beutler Lab
Gene Symbol Uqcc1
Ensembl Gene ENSMUSG00000005882
Gene Nameubiquinol-cytochrome c reductase complex assembly factor 1
SynonymsBfzp, 3110038N19Rik, 2410003P15Rik, 2310079L17Rik, Cbp3, mbFZb, Uqcc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.500) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155846894-155930310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155911811 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000105264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006036] [ENSMUST00000109631] [ENSMUST00000109632] [ENSMUST00000109636] [ENSMUST00000133726] [ENSMUST00000136933] [ENSMUST00000142655] [ENSMUST00000151078] [ENSMUST00000152766] [ENSMUST00000159238]
Predicted Effect probably benign
Transcript: ENSMUST00000006036
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006036
Gene: ENSMUSG00000005882
AA Change: V48A

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 105 191 8.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109631
SMART Domains Protein: ENSMUSP00000105259
Gene: ENSMUSG00000005882

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 63 203 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109632
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105260
Gene: ENSMUSG00000005882
AA Change: V48A

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 191 4.3e-19 PFAM
Pfam:Ubiq_cyt_C_chap 188 245 2.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109636
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105264
Gene: ENSMUSG00000005882
AA Change: V48A

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 271 6.7e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133726
AA Change: V48A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000136933
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000139232
SMART Domains Protein: ENSMUSP00000123019
Gene: ENSMUSG00000005882

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142655
Predicted Effect probably benign
Transcript: ENSMUST00000151078
Predicted Effect probably benign
Transcript: ENSMUST00000152766
AA Change: V42A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122886
Gene: ENSMUSG00000005882
AA Change: V42A

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 3.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159238
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Uqcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Uqcc1 APN 2 155858138 missense probably damaging 1.00
IGL02883:Uqcc1 APN 2 155911829 missense possibly damaging 0.93
R0433:Uqcc1 UTSW 2 155910368 missense probably damaging 1.00
R1506:Uqcc1 UTSW 2 155911818 missense probably damaging 0.98
R1579:Uqcc1 UTSW 2 155921721 nonsense probably null
R4801:Uqcc1 UTSW 2 155858106 splice site probably benign
R5049:Uqcc1 UTSW 2 155910421 missense probably damaging 1.00
R6042:Uqcc1 UTSW 2 155921644 missense possibly damaging 0.48
R6526:Uqcc1 UTSW 2 155851423 missense probably damaging 1.00
R7548:Uqcc1 UTSW 2 155909389 missense probably damaging 1.00
R7721:Uqcc1 UTSW 2 155858146 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCAGGCTATCTGCTCAGGAGAC -3'
(R):5'- GGTACATACCAGATGCTGTTCTG -3'

Sequencing Primer
(F):5'- CAGAGGTGCACATATTCAGTTAG -3'
(R):5'- CAGATGCTGTTCTGGGTGCC -3'
Posted On2019-09-13