Incidental Mutation 'R7331:Bglap2'
ID569228
Institutional Source Beutler Lab
Gene Symbol Bglap2
Ensembl Gene ENSMUSG00000074486
Gene Namebone gamma-carboxyglutamate protein 2
SynonymsmOC-B, OG2, bone Gla protein, osteocalcin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88377736-88378699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88378260 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 35 (M35K)
Ref Sequence ENSEMBL: ENSMUSP00000096555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098956
AA Change: M35K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096555
Gene: ENSMUSG00000074486
AA Change: M35K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a hormone that is secreted by osteoblasts and may function in bone remodeling and energy metabolism. Homozygous knockout mice for this gene exhibit a gradual increase in bone size, density and strength, as well as elevated adiposity and impaired glucose tolerance. This gene is present in a gene cluster with other related genes on chromosome 3. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of both Bglap1 and Bglap2 exhibit decreased circulating insulin, impaired glucose tolerance, increased adipose tissue, increased bone density, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Bglap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Bglap2 APN 3 88377936 nonsense probably null
IGL02739:Bglap2 APN 3 88378012 splice site probably null
R0402:Bglap2 UTSW 3 88378245 missense probably damaging 1.00
R0694:Bglap2 UTSW 3 88378416 missense possibly damaging 0.64
R1846:Bglap2 UTSW 3 88378625 unclassified probably benign
R5114:Bglap2 UTSW 3 88382125 unclassified probably benign
R7677:Bglap2 UTSW 3 88377973 missense probably damaging 1.00
R7696:Bglap2 UTSW 3 88378616 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGGCATTAATATACACGGGGTAC -3'
(R):5'- TTACAGATGCCAAGCCCAGC -3'

Sequencing Primer
(F):5'- CACTGTACAAGAGGCTCCAGG -3'
(R):5'- CGGCCCTGAGTCTGACAAAG -3'
Posted On2019-09-13