Incidental Mutation 'R7331:Rfc1'
ID569230
Institutional Source Beutler Lab
Gene Symbol Rfc1
Ensembl Gene ENSMUSG00000029191
Gene Namereplication factor C (activator 1) 1
Synonyms140kDa, Recc1, Alp145, RFC140
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65261850-65335670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65311044 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 109 (T109A)
Ref Sequence ENSEMBL: ENSMUSP00000145385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]
Predicted Effect probably damaging
Transcript: ENSMUST00000172732
AA Change: T109A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203471
AA Change: T109A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203581
AA Change: T109A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204965
AA Change: T109A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Rfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Rfc1 APN 5 65296009 missense probably benign 0.00
IGL00909:Rfc1 APN 5 65279699 missense probably benign 0.00
IGL01791:Rfc1 APN 5 65263145 missense probably benign 0.00
IGL01884:Rfc1 APN 5 65274460 missense possibly damaging 0.94
IGL02737:Rfc1 APN 5 65311163 missense possibly damaging 0.82
Disturbing UTSW 5 65266162 missense probably damaging 1.00
P0038:Rfc1 UTSW 5 65287961 missense probably damaging 1.00
R0317:Rfc1 UTSW 5 65296052 splice site probably null
R0452:Rfc1 UTSW 5 65264297 missense probably benign 0.01
R0699:Rfc1 UTSW 5 65319399 splice site probably null
R0945:Rfc1 UTSW 5 65278709 critical splice donor site probably null
R1192:Rfc1 UTSW 5 65293911 missense probably benign 0.03
R1341:Rfc1 UTSW 5 65291194 missense probably damaging 1.00
R1425:Rfc1 UTSW 5 65319518 missense probably damaging 1.00
R1551:Rfc1 UTSW 5 65277363 missense probably damaging 0.99
R1800:Rfc1 UTSW 5 65264379 missense probably damaging 1.00
R1969:Rfc1 UTSW 5 65319524 missense probably damaging 1.00
R2006:Rfc1 UTSW 5 65311054 nonsense probably null
R2026:Rfc1 UTSW 5 65288029 missense probably damaging 1.00
R2073:Rfc1 UTSW 5 65301939 missense probably damaging 0.98
R2137:Rfc1 UTSW 5 65311039 critical splice donor site probably null
R2330:Rfc1 UTSW 5 65312969 missense possibly damaging 0.94
R3774:Rfc1 UTSW 5 65264406 missense probably damaging 1.00
R3787:Rfc1 UTSW 5 65296014 missense probably benign 0.00
R4920:Rfc1 UTSW 5 65287928 missense probably damaging 1.00
R5055:Rfc1 UTSW 5 65266162 missense probably damaging 1.00
R5308:Rfc1 UTSW 5 65279461 missense probably damaging 0.99
R5723:Rfc1 UTSW 5 65277426 missense probably null 0.78
R5729:Rfc1 UTSW 5 65277452 missense probably damaging 1.00
R5844:Rfc1 UTSW 5 65293787 missense probably benign 0.19
R6045:Rfc1 UTSW 5 65279549 missense probably damaging 1.00
R6484:Rfc1 UTSW 5 65293677 missense probably benign 0.01
R6495:Rfc1 UTSW 5 65273815 intron probably null
R6531:Rfc1 UTSW 5 65312979 missense possibly damaging 0.92
R6717:Rfc1 UTSW 5 65302004 nonsense probably null
R6717:Rfc1 UTSW 5 65312961 missense probably damaging 0.97
R6845:Rfc1 UTSW 5 65311116 missense possibly damaging 0.53
R6880:Rfc1 UTSW 5 65277386 missense probably benign 0.14
R7329:Rfc1 UTSW 5 65263135 missense unknown
R7466:Rfc1 UTSW 5 65275426 missense probably damaging 1.00
R7497:Rfc1 UTSW 5 65279498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAGGATAGGACTATAGCTAAGTG -3'
(R):5'- GTGACACGCTTCAGACATGAG -3'

Sequencing Primer
(F):5'- CTAAGTGATAGAGTGTTTGCCAGC -3'
(R):5'- AAGACACGCTTCTTGGGG -3'
Posted On2019-09-13