Incidental Mutation 'R7331:Zyx'
ID569233
Institutional Source Beutler Lab
Gene Symbol Zyx
Ensembl Gene ENSMUSG00000029860
Gene Namezyxin
SynonymsR75157
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42349630-42360213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42351659 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 230 (H230R)
Ref Sequence ENSEMBL: ENSMUSP00000126622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070635] [ENSMUST00000164375] [ENSMUST00000203329] [ENSMUST00000203401] [ENSMUST00000203652] [ENSMUST00000203846] [ENSMUST00000203849]
Predicted Effect probably benign
Transcript: ENSMUST00000070635
AA Change: H199R

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070427
Gene: ENSMUSG00000029860
AA Change: H199R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
AA Change: H230R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860
AA Change: H230R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203329
SMART Domains Protein: ENSMUSP00000144863
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203401
AA Change: H199R

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145236
Gene: ENSMUSG00000029860
AA Change: H199R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 168 189 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 312 332 N/A INTRINSIC
LIM 344 397 2.4e-17 SMART
LIM 404 456 7.39e-18 SMART
LIM 464 526 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203652
AA Change: H230R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145451
Gene: ENSMUSG00000029860
AA Change: H230R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203846
SMART Domains Protein: ENSMUSP00000145189
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203849
SMART Domains Protein: ENSMUSP00000145052
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene are viable, fertile, and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Other mutations in Zyx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Zyx APN 6 42350444 missense probably damaging 0.99
IGL02418:Zyx APN 6 42357393 missense probably damaging 1.00
IGL03090:Zyx APN 6 42357342 nonsense probably null
R0282:Zyx UTSW 6 42356005 missense probably damaging 1.00
R0449:Zyx UTSW 6 42351313 missense probably damaging 1.00
R1496:Zyx UTSW 6 42356312 missense probably damaging 1.00
R1666:Zyx UTSW 6 42356032 missense possibly damaging 0.48
R1668:Zyx UTSW 6 42356032 missense possibly damaging 0.48
R1956:Zyx UTSW 6 42351355 missense probably damaging 1.00
R4272:Zyx UTSW 6 42350946 missense probably damaging 1.00
R4766:Zyx UTSW 6 42356159 splice site probably null
R4817:Zyx UTSW 6 42356487 missense probably damaging 1.00
R5216:Zyx UTSW 6 42356532 missense probably damaging 0.96
R6981:Zyx UTSW 6 42350357 missense unknown
R7553:Zyx UTSW 6 42350474 missense probably null 0.99
R7665:Zyx UTSW 6 42356162 missense probably damaging 0.99
RF020:Zyx UTSW 6 42357396 missense probably damaging 1.00
X0022:Zyx UTSW 6 42356026 missense probably benign 0.01
X0028:Zyx UTSW 6 42351078 missense probably damaging 0.99
X0064:Zyx UTSW 6 42357315 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCTTGCAGGTATCATCCGG -3'
(R):5'- TTCTGCTGAGCATAGGTGAAGC -3'

Sequencing Primer
(F):5'- GCAGGTATCATCCGGATATGTACC -3'
(R):5'- TGCTCACAGAAGAAGGAGCATCC -3'
Posted On2019-09-13