Incidental Mutation 'R7331:Cycs'
ID569234
Institutional Source Beutler Lab
Gene Symbol Cycs
Ensembl Gene ENSMUSG00000063694
Gene Namecytochrome c, somatic
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location50562563-50566538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50565552 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 37 (F37L)
Ref Sequence ENSEMBL: ENSMUSP00000124523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161401]
Predicted Effect probably benign
Transcript: ENSMUST00000161401
AA Change: F37L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124523
Gene: ENSMUSG00000063694
AA Change: F37L

DomainStartEndE-ValueType
Pfam:Cytochrom_C 4 103 6.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation die at midgestation. By E8.5, homozygous null embryos exhibit a strikingly reduced size and are developmentally retarded. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Cycs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Cycs APN 6 50565367 missense probably benign 0.01
R1854:Cycs UTSW 6 50565329 missense possibly damaging 0.85
R6622:Cycs UTSW 6 50566463 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAATACTCCATCAGGGTATCC -3'
(R):5'- CTGCCTGGTGTTAAGAGGAC -3'

Sequencing Primer
(F):5'- GGTATCCTCTCCCCAGGTGATG -3'
(R):5'- CTGCCTGGTGTTAAGAGGACATAAG -3'
Posted On2019-09-13