Incidental Mutation 'R7331:Atg16l2'
ID569239
Institutional Source Beutler Lab
Gene Symbol Atg16l2
Ensembl Gene ENSMUSG00000047767
Gene Nameautophagy related 16-like 2 (S. cerevisiae)
Synonyms2410118P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101263034-101302251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101299048 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 96 (K96N)
Ref Sequence ENSEMBL: ENSMUSP00000112500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120267] [ENSMUST00000122116] [ENSMUST00000139609] [ENSMUST00000140553] [ENSMUST00000143630] [ENSMUST00000207121]
Predicted Effect probably damaging
Transcript: ENSMUST00000120267
AA Change: K96N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767
AA Change: K96N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122116
AA Change: K96N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767
AA Change: K96N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139609
AA Change: K96N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767
AA Change: K96N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140553
SMART Domains Protein: ENSMUSP00000116414
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143630
AA Change: K96N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767
AA Change: K96N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207121
Meta Mutation Damage Score 0.3593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Atg16l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Atg16l2 APN 7 101300160 missense probably damaging 1.00
IGL00402:Atg16l2 APN 7 101296153 missense probably benign 0.00
IGL00662:Atg16l2 APN 7 101289896 missense probably benign 0.00
IGL00905:Atg16l2 APN 7 101300166 missense probably damaging 1.00
IGL01644:Atg16l2 APN 7 101297217 makesense probably null
IGL02839:Atg16l2 APN 7 101293397 missense probably damaging 1.00
R0316:Atg16l2 UTSW 7 101293396 missense probably damaging 1.00
R0638:Atg16l2 UTSW 7 101300110 critical splice donor site probably null
R0683:Atg16l2 UTSW 7 101290384 missense probably damaging 1.00
R1436:Atg16l2 UTSW 7 101291550 missense probably damaging 1.00
R1592:Atg16l2 UTSW 7 101291986 missense probably damaging 1.00
R1623:Atg16l2 UTSW 7 101289906 missense probably benign 0.01
R2002:Atg16l2 UTSW 7 101294920 missense possibly damaging 0.62
R2090:Atg16l2 UTSW 7 101293368 splice site probably null
R2103:Atg16l2 UTSW 7 101290361 critical splice donor site probably null
R2349:Atg16l2 UTSW 7 101296539 missense probably damaging 0.96
R4738:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4739:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4740:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R5704:Atg16l2 UTSW 7 101300211 missense probably damaging 1.00
R6243:Atg16l2 UTSW 7 101292329 makesense probably null
R6257:Atg16l2 UTSW 7 101301895 splice site probably null
R6613:Atg16l2 UTSW 7 101290581 critical splice donor site probably null
R7349:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
R7719:Atg16l2 UTSW 7 101289867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCCAGGGTCCACATC -3'
(R):5'- ACCATCATAGAGCAGAGAGGTC -3'

Sequencing Primer
(F):5'- GTCCAGGGTCCACATCTCTAAG -3'
(R):5'- CATGGGTAGCTTATTATTTCTGAGAC -3'
Posted On2019-09-13