Incidental Mutation 'R7331:Cdc34'
ID569243
Institutional Source Beutler Lab
Gene Symbol Cdc34
Ensembl Gene ENSMUSG00000020307
Gene Namecell division cycle 34
SynonymsUBE2R1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79682195-79688398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79685312 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 148 (Y148H)
Ref Sequence ENSEMBL: ENSMUSP00000020550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020549] [ENSMUST00000020550] [ENSMUST00000166603] [ENSMUST00000218938] [ENSMUST00000218964] [ENSMUST00000219389] [ENSMUST00000219791] [ENSMUST00000219930]
Predicted Effect probably benign
Transcript: ENSMUST00000020549
SMART Domains Protein: ENSMUSP00000020549
Gene: ENSMUSG00000054206

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 26 251 4.6e-74 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000020550
AA Change: Y148H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020550
Gene: ENSMUSG00000020307
AA Change: Y148H

DomainStartEndE-ValueType
UBCc 11 174 9.27e-64 SMART
low complexity region 207 220 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166603
AA Change: Y148H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128806
Gene: ENSMUSG00000020307
AA Change: Y148H

DomainStartEndE-ValueType
UBCc 11 174 9.27e-64 SMART
low complexity region 207 220 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218938
Predicted Effect probably damaging
Transcript: ENSMUST00000218964
AA Change: Y128H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000219389
AA Change: Y68H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219791
Predicted Effect probably damaging
Transcript: ENSMUST00000219930
AA Change: Y132H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000220328
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ubiquitin-conjugating enzyme family. Ubiquitin-conjugating enzyme catalyzes the covalent attachment of ubiquitin to other proteins. This protein is a part of the large multiprotein complex, which is required for ubiquitin-mediated degradation of cell cycle G1 regulators, and for the initiation of DNA replication. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Cdc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02240:Cdc34 APN 10 79687989 missense possibly damaging 0.90
R1344:Cdc34 UTSW 10 79685300 missense probably damaging 1.00
R1635:Cdc34 UTSW 10 79688054 missense probably benign 0.23
R1764:Cdc34 UTSW 10 79685340 missense probably benign 0.00
R1764:Cdc34 UTSW 10 79685338 intron probably null
R4584:Cdc34 UTSW 10 79688035 missense possibly damaging 0.46
R5251:Cdc34 UTSW 10 79685256 missense probably damaging 0.99
R5609:Cdc34 UTSW 10 79684821 missense probably damaging 0.97
R6913:Cdc34 UTSW 10 79685103 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGTATCCTAAGGTCCC -3'
(R):5'- ACTAGGTGGTCAACTCGGTG -3'

Sequencing Primer
(F):5'- GTATCCTAAGGTCCCTTCTTCCTCG -3'
(R):5'- TCCAGCTGGGGATGCAAG -3'
Posted On2019-09-13