Incidental Mutation 'R7331:Gabarap'
ID569245
Institutional Source Beutler Lab
Gene Symbol Gabarap
Ensembl Gene ENSMUSG00000018567
Gene Namegamma-aminobutyric acid receptor associated protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69991143-69994951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69994472 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000018711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018711] [ENSMUST00000018716] [ENSMUST00000101526] [ENSMUST00000108592] [ENSMUST00000108593] [ENSMUST00000133485] [ENSMUST00000135814] [ENSMUST00000138186] [ENSMUST00000141623] [ENSMUST00000153684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018711
AA Change: E101G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018711
Gene: ENSMUSG00000018567
AA Change: E101G

DomainStartEndE-ValueType
Pfam:Atg8 13 116 1.8e-51 PFAM
Pfam:APG12 30 116 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018716
SMART Domains Protein: ENSMUSP00000018716
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 225 241 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 263 286 N/A INTRINSIC
PHD 339 383 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101526
SMART Domains Protein: ENSMUSP00000099064
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 158 174 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 196 219 N/A INTRINSIC
PHD 272 316 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108592
AA Change: K70E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104233
Gene: ENSMUSG00000018567
AA Change: K70E

DomainStartEndE-ValueType
Pfam:Atg8 13 93 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108593
SMART Domains Protein: ENSMUSP00000104234
Gene: ENSMUSG00000018559

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
CPDc 60 212 7.35e-76 SMART
low complexity region 214 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133485
SMART Domains Protein: ENSMUSP00000117373
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135814
SMART Domains Protein: ENSMUSP00000120665
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138186
SMART Domains Protein: ENSMUSP00000117635
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 178 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141623
SMART Domains Protein: ENSMUSP00000137199
Gene: ENSMUSG00000018559

DomainStartEndE-ValueType
CPDc 1 79 6.29e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153684
SMART Domains Protein: ENSMUSP00000121780
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Gabarap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1480:Gabarap UTSW 11 69991725 missense probably damaging 1.00
R1728:Gabarap UTSW 11 69991689 unclassified probably benign
R1729:Gabarap UTSW 11 69991689 unclassified probably benign
R1730:Gabarap UTSW 11 69991689 unclassified probably benign
R1783:Gabarap UTSW 11 69991689 unclassified probably benign
R1784:Gabarap UTSW 11 69991689 unclassified probably benign
R1785:Gabarap UTSW 11 69991689 unclassified probably benign
R2142:Gabarap UTSW 11 69991689 unclassified probably benign
R4603:Gabarap UTSW 11 69994461 missense probably benign 0.04
R4832:Gabarap UTSW 11 69991852 unclassified probably benign
R6377:Gabarap UTSW 11 69991804 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGGTTCTTAAGTTGCCTTG -3'
(R):5'- GAGGCTGTATCTACCATTACCCC -3'

Sequencing Primer
(F):5'- AAGTTGCCTTGGTAGCCTTTAC -3'
(R):5'- GCCTCAAACATTAAGTGCAGGTC -3'
Posted On2019-09-13