Incidental Mutation 'R7331:Ctsj'
ID569251
Institutional Source Beutler Lab
Gene Symbol Ctsj
Ensembl Gene ENSMUSG00000055298
Gene Namecathepsin J
SynonymsCatRLP, rat gene/Cathepsin L-related protein, Cat P, CATP, Ctsp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location61000179-61005959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61003831 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 90 (S90L)
Ref Sequence ENSEMBL: ENSMUSP00000071457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071526] [ENSMUST00000224224]
Predicted Effect probably benign
Transcript: ENSMUST00000071526
AA Change: S90L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071457
Gene: ENSMUSG00000055298
AA Change: S90L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 29 87 1.18e-21 SMART
Pept_C1 113 331 3.3e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224224
AA Change: S91L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Ctsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ctsj APN 13 61001418 missense possibly damaging 0.66
IGL02199:Ctsj APN 13 61002537 missense probably damaging 0.99
IGL02630:Ctsj APN 13 61001400 missense probably damaging 1.00
IGL02809:Ctsj APN 13 61003160 missense probably damaging 1.00
IGL03066:Ctsj APN 13 61004488 missense possibly damaging 0.49
IGL02799:Ctsj UTSW 13 61003820 missense probably benign 0.01
PIT4581001:Ctsj UTSW 13 61002556 missense probably damaging 1.00
R0094:Ctsj UTSW 13 61003705 critical splice donor site probably null
R0586:Ctsj UTSW 13 61003701 splice site probably benign
R0841:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1145:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1145:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1146:Ctsj UTSW 13 61002498 missense probably benign 0.07
R1146:Ctsj UTSW 13 61002498 missense probably benign 0.07
R2201:Ctsj UTSW 13 61002549 missense probably damaging 1.00
R2402:Ctsj UTSW 13 61000574 missense probably damaging 1.00
R5081:Ctsj UTSW 13 61003850 missense possibly damaging 0.94
R5325:Ctsj UTSW 13 61004025 missense possibly damaging 0.93
R5416:Ctsj UTSW 13 61004523 missense probably damaging 1.00
R5776:Ctsj UTSW 13 61003142 missense probably damaging 1.00
R6802:Ctsj UTSW 13 61003074 missense probably benign 0.25
R7072:Ctsj UTSW 13 61003083 nonsense probably null
R7386:Ctsj UTSW 13 61000559 missense possibly damaging 0.74
R7853:Ctsj UTSW 13 61004070 missense probably damaging 1.00
R7936:Ctsj UTSW 13 61004070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCACATCTCTCCATGC -3'
(R):5'- AAATTTGGTGACCAGGTGAGTG -3'

Sequencing Primer
(F):5'- GCACATCTCTCCATGCTCAATAC -3'
(R):5'- GTGACATGGATTGCTTCACAC -3'
Posted On2019-09-13