Incidental Mutation 'R7331:Phf21b'
ID569257
Institutional Source Beutler Lab
Gene Symbol Phf21b
Ensembl Gene ENSMUSG00000016624
Gene NamePHD finger protein 21B
SynonymsA730032D07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7331 (G1)
Quality Score134.008
Status Validated
Chromosome15
Chromosomal Location84785381-84856049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 84791094 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 405 (R405G)
Ref Sequence ENSEMBL: ENSMUSP00000125355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016768] [ENSMUST00000159939] [ENSMUST00000162044]
Predicted Effect probably benign
Transcript: ENSMUST00000016768
AA Change: R393G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016768
Gene: ENSMUSG00000016624
AA Change: R393G

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
PHD 297 340 6.64e-10 SMART
coiled coil region 368 403 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159939
AA Change: R405G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125355
Gene: ENSMUSG00000016624
AA Change: R405G

DomainStartEndE-ValueType
low complexity region 200 214 N/A INTRINSIC
PHD 309 352 6.64e-10 SMART
coiled coil region 380 415 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162044
SMART Domains Protein: ENSMUSP00000124941
Gene: ENSMUSG00000016624

DomainStartEndE-ValueType
low complexity region 200 214 N/A INTRINSIC
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Phf21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Phf21b APN 15 84808061 splice site probably benign
IGL02311:Phf21b APN 15 84793894 critical splice donor site probably null
IGL02700:Phf21b APN 15 84803461 missense probably benign 0.00
IGL03201:Phf21b APN 15 84787247 missense probably benign 0.32
R0113:Phf21b UTSW 15 84804767 missense probably damaging 1.00
R1464:Phf21b UTSW 15 84804959 missense probably damaging 0.99
R1464:Phf21b UTSW 15 84804959 missense probably damaging 0.99
R1529:Phf21b UTSW 15 84797396 missense probably damaging 1.00
R1834:Phf21b UTSW 15 84797346 missense probably damaging 1.00
R1854:Phf21b UTSW 15 84854762 missense probably benign 0.41
R3683:Phf21b UTSW 15 84798690 missense probably damaging 1.00
R4729:Phf21b UTSW 15 84854741 nonsense probably null
R5476:Phf21b UTSW 15 84787265 missense probably benign
R5526:Phf21b UTSW 15 84791805 missense probably benign 0.00
R5659:Phf21b UTSW 15 84793900 nonsense probably null
R6208:Phf21b UTSW 15 84795116 missense probably damaging 0.97
R6281:Phf21b UTSW 15 84854745 missense probably benign 0.02
R6288:Phf21b UTSW 15 84855071 intron probably benign
R6322:Phf21b UTSW 15 84787379 missense possibly damaging 0.94
R6875:Phf21b UTSW 15 84787446 missense probably damaging 1.00
R7087:Phf21b UTSW 15 84791832 missense probably damaging 1.00
R7296:Phf21b UTSW 15 84855717 start codon destroyed probably null 0.77
R7439:Phf21b UTSW 15 84804903 missense probably damaging 1.00
R7744:Phf21b UTSW 15 84804869 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCACCTTCACAGCTGAG -3'
(R):5'- TGCATTCATATGGGACCTTGG -3'

Sequencing Primer
(F):5'- TTCACAGCTGAGGCCATG -3'
(R):5'- TTCTTCTGAGCCAGGGCACTG -3'
Posted On2019-09-13