Incidental Mutation 'R7331:Ttc3'
ID569259
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94394359 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 290 (F290L)
Ref Sequence ENSEMBL: ENSMUSP00000113311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000119131] [ENSMUST00000122895] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145432] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000149885] [ENSMUST00000150097] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153062] [ENSMUST00000153988] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000232660]
Predicted Effect probably benign
Transcript: ENSMUST00000117648
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119131
AA Change: F290L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113311
Gene: ENSMUSG00000040785
AA Change: F290L

DomainStartEndE-ValueType
Pfam:TPR_11 229 285 1.1e-12 PFAM
Pfam:TPR_1 232 264 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122895
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127667
SMART Domains Protein: ENSMUSP00000122425
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 22 89 4.7e-16 PFAM
Pfam:TPR_2 24 57 5.7e-4 PFAM
Pfam:TPR_1 25 57 3.5e-5 PFAM
Pfam:TPR_9 35 103 3.2e-6 PFAM
Pfam:TPR_1 58 89 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141856
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000145432
Predicted Effect probably benign
Transcript: ENSMUST00000145883
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147352
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149885
SMART Domains Protein: ENSMUSP00000122006
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_2 1 31 3.5e-4 PFAM
Pfam:TPR_11 1 58 7.8e-16 PFAM
Pfam:TPR_1 2 31 1.8e-5 PFAM
Pfam:TPR_9 9 58 2.5e-6 PFAM
Pfam:TPR_17 20 53 4.2e-7 PFAM
Pfam:TPR_1 32 58 2.5e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150346
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151770
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153062
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155692
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Predicted Effect probably benign
Transcript: ENSMUST00000232395
Predicted Effect probably benign
Transcript: ENSMUST00000232660
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 unclassified probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCGAGCTCAGACGCTGTTC -3'
(R):5'- AATAGATGACCCTCTGCCTGC -3'

Sequencing Primer
(F):5'- CTCAGACGCTGTTCCTTAGTGAAAAC -3'
(R):5'- TGTTAATTCTGGACCTAGCCAG -3'
Posted On2019-09-13