Incidental Mutation 'R7331:Stard6'
ID569266
Institutional Source Beutler Lab
Gene Symbol Stard6
Ensembl Gene ENSMUSG00000079608
Gene NameStAR-related lipid transfer (START) domain containing 6
Synonyms1700011K09Rik, 4833424I06Rik, 4933429L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location70472454-70501066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70483482 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 71 (R71G)
Ref Sequence ENSEMBL: ENSMUSP00000110609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667]
Predicted Effect probably damaging
Transcript: ENSMUST00000114959
AA Change: R71G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608
AA Change: R71G

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164223
AA Change: R71G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608
AA Change: R71G

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168249
AA Change: R71G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608
AA Change: R71G

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174118
AA Change: R71G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608
AA Change: R71G

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fastkd5 A T 2: 130,615,727 N314K possibly damaging Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Stard6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Stard6 APN 18 70483488 missense probably benign 0.00
IGL02403:Stard6 APN 18 70496112 critical splice acceptor site probably null
IGL02934:Stard6 APN 18 70496104 splice site probably benign
IGL03144:Stard6 APN 18 70476111 missense possibly damaging 0.53
R0344:Stard6 UTSW 18 70496115 missense probably damaging 1.00
R2850:Stard6 UTSW 18 70483451 missense probably benign 0.20
R2896:Stard6 UTSW 18 70476388 missense probably benign 0.02
R3236:Stard6 UTSW 18 70500486 missense probably damaging 0.99
R4532:Stard6 UTSW 18 70483534 missense probably damaging 1.00
R4959:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R4973:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R5080:Stard6 UTSW 18 70496222 missense probably damaging 1.00
R6380:Stard6 UTSW 18 70476388 missense probably benign 0.02
R7396:Stard6 UTSW 18 70500435 missense possibly damaging 0.95
R7399:Stard6 UTSW 18 70498647 splice site probably null
R8002:Stard6 UTSW 18 70500526 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGGATACTCAATTGCTTCACTGTTC -3'
(R):5'- CAGAGGTATACATCGTGTGGGG -3'

Sequencing Primer
(F):5'- ACTCAATTGCTTCACTGTTCTTTGC -3'
(R):5'- GAATGGTCCTTGGTTCAGTCCC -3'
Posted On2019-09-13