Incidental Mutation 'R7332:Tmeff2'
ID569269
Institutional Source Beutler Lab
Gene Symbol Tmeff2
Ensembl Gene ENSMUSG00000026109
Gene Nametransmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms4832418D20Rik, 7630402F16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location50900647-51187270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50979440 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 194 (W194R)
Ref Sequence ENSEMBL: ENSMUSP00000110212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081851] [ENSMUST00000114565]
Predicted Effect probably benign
Transcript: ENSMUST00000081851
SMART Domains Protein: ENSMUSP00000080533
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
KAZAL 181 227 6.05e-13 SMART
EGF 264 301 3.57e-2 SMART
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114565
AA Change: W194R
SMART Domains Protein: ENSMUSP00000110212
Gene: ENSMUSG00000026109
AA Change: W194R

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele display slow postnatal weight gain, decreased white adipose tissue amount, and complete lethality at weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Tmeff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Tmeff2 APN 1 51185450 missense probably damaging 1.00
IGL00707:Tmeff2 APN 1 51133053 splice site probably null
IGL01096:Tmeff2 APN 1 50930546 splice site probably benign
IGL01897:Tmeff2 APN 1 51132210 missense probably damaging 1.00
IGL02797:Tmeff2 APN 1 50928047 missense probably damaging 1.00
IGL03245:Tmeff2 APN 1 51181817 missense probably benign 0.30
R0454:Tmeff2 UTSW 1 50928075 missense possibly damaging 0.92
R0975:Tmeff2 UTSW 1 50938205 splice site probably benign
R1161:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1310:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1457:Tmeff2 UTSW 1 51181867 missense probably damaging 1.00
R3001:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3002:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3424:Tmeff2 UTSW 1 50979617 intron probably benign
R4807:Tmeff2 UTSW 1 50979387 missense probably benign 0.01
R4923:Tmeff2 UTSW 1 50930645 missense probably benign 0.29
R4977:Tmeff2 UTSW 1 50979556 nonsense probably null
R5176:Tmeff2 UTSW 1 51071541 nonsense probably null
R5220:Tmeff2 UTSW 1 50979317 missense probably benign 0.01
R5919:Tmeff2 UTSW 1 51132152 nonsense probably null
R5990:Tmeff2 UTSW 1 50979442 nonsense probably null
R6353:Tmeff2 UTSW 1 51181826 missense probably damaging 1.00
R6358:Tmeff2 UTSW 1 51133114 nonsense probably null
R6925:Tmeff2 UTSW 1 50928021 missense probably damaging 0.99
R7114:Tmeff2 UTSW 1 51185245 splice site probably null
R7163:Tmeff2 UTSW 1 50938344 critical splice donor site probably null
R7762:Tmeff2 UTSW 1 50979416 missense probably benign 0.04
R8223:Tmeff2 UTSW 1 51133120 critical splice donor site probably null
R8260:Tmeff2 UTSW 1 50938319 missense probably damaging 0.97
R8301:Tmeff2 UTSW 1 51181837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGGATGTTACCGGACACTGG -3'
(R):5'- TTCCCCAAAGTGTCTCAGACTTAAG -3'

Sequencing Primer
(F):5'- GATGTTACCGGACACTGGAATCAC -3'
(R):5'- TGTCTCAGACTTAAGGAACTGG -3'
Posted On2019-09-13