Incidental Mutation 'R7332:Egfl7'
ID569275
Institutional Source Beutler Lab
Gene Symbol Egfl7
Ensembl Gene ENSMUSG00000026921
Gene NameEGF-like domain 7
SynonymsZneu1, vascular endothelial-statin, VE-statin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26580014-26593120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26590713 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 128 (R128S)
Ref Sequence ENSEMBL: ENSMUSP00000099971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000100290] [ENSMUST00000102907] [ENSMUST00000139801] [ENSMUST00000145575] [ENSMUST00000149789] [ENSMUST00000150404] [ENSMUST00000152713] [ENSMUST00000152988] [ENSMUST00000166920] [ENSMUST00000173920] [ENSMUST00000174066] [ENSMUST00000174211]
Predicted Effect probably benign
Transcript: ENSMUST00000028286
SMART Domains Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
PlsC 92 207 5.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100290
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097863
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.5e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102907
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099971
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 32 98 5.6e-21 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131112
Predicted Effect silent
Transcript: ENSMUST00000139801
SMART Domains Protein: ENSMUSP00000123465
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 6.9e-20 PFAM
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145575
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118924
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 8e-20 PFAM
EGF 110 139 2.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149789
Predicted Effect probably benign
Transcript: ENSMUST00000150404
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115482
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152713
Predicted Effect probably benign
Transcript: ENSMUST00000152988
Predicted Effect probably benign
Transcript: ENSMUST00000166920
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128741
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173920
SMART Domains Protein: ENSMUSP00000134503
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174066
AA Change: P50Q
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356
AA Change: P50Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174211
AA Change: R128S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134034
Gene: ENSMUSG00000026921
AA Change: R128S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174656
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality with absent heartbeat and systemic edema, delayed vasculogenesis, decreased angiogenesis, abnormal adult vasculature, and low-level hypoxia. Mice homozygous for a null allele that does not disrupt Mirn126 expression are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Egfl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03279:Egfl7 APN 2 26590707 missense probably benign 0.08
PIT4362001:Egfl7 UTSW 2 26591040 missense probably benign
R0607:Egfl7 UTSW 2 26589440 missense probably damaging 1.00
R0678:Egfl7 UTSW 2 26590940 missense probably benign 0.02
R2404:Egfl7 UTSW 2 26589150 missense possibly damaging 0.88
R4921:Egfl7 UTSW 2 26590980 missense probably benign 0.05
R5572:Egfl7 UTSW 2 26591691 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGTGCACTGTGCCTGATG -3'
(R):5'- ACAACTGGCCTCTCCTGTACTG -3'

Sequencing Primer
(F):5'- GGACTCCACTGCCCATCATTG -3'
(R):5'- TGTACTGCATTCATCAACATCTG -3'
Posted On2019-09-13