Incidental Mutation 'R7332:Kirrel1'
ID 569280
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 045425-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7332 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86995705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 410 (I410V)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect possibly damaging
Transcript: ENSMUST00000041732
AA Change: I410V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: I410V

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107618
AA Change: I410V

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: I410V

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159976
AA Change: I410V

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: I410V

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,906,553 (GRCm39) S449P probably damaging Het
Atp6v0c A C 17: 24,388,198 (GRCm39) S21A probably benign Het
Cacna1e T C 1: 154,601,547 (GRCm39) Y40C possibly damaging Het
Cdadc1 A G 14: 59,813,213 (GRCm39) I398T possibly damaging Het
Cfap44 T A 16: 44,250,191 (GRCm39) D756E probably damaging Het
Clcnkb A T 4: 141,141,243 (GRCm39) L104Q probably null Het
Clk1 G A 1: 58,451,853 (GRCm39) H421Y probably benign Het
Cmpk2 A T 12: 26,528,061 (GRCm39) D426V probably damaging Het
Cmya5 A G 13: 93,229,061 (GRCm39) L2009S possibly damaging Het
Col5a2 C G 1: 45,419,325 (GRCm39) D1252H probably damaging Het
Coro1b A G 19: 4,199,356 (GRCm39) K5R probably benign Het
Csmd2 A G 4: 128,313,360 (GRCm39) T1346A Het
Csrp1 G T 1: 135,667,149 (GRCm39) W4L probably benign Het
Cyp3a25 A G 5: 145,929,817 (GRCm39) I184T probably damaging Het
Egfl7 C A 2: 26,480,725 (GRCm39) R128S probably benign Het
Fggy A T 4: 95,511,719 (GRCm39) N157I probably damaging Het
Gldc A T 19: 30,093,926 (GRCm39) L697Q probably damaging Het
Gm4952 T A 19: 12,604,373 (GRCm39) Y262N probably damaging Het
Gsap T A 5: 21,495,119 (GRCm39) M821K probably benign Het
Hps1 T C 19: 42,766,351 (GRCm39) probably null Het
Hsbp1l1 T C 18: 80,280,038 (GRCm39) probably benign Het
Igfbp7 G A 5: 77,499,803 (GRCm39) T220I probably damaging Het
Ints3 T C 3: 90,322,819 (GRCm39) Q137R probably damaging Het
Kcna6 A G 6: 126,716,292 (GRCm39) F199S possibly damaging Het
Llgl2 T C 11: 115,739,125 (GRCm39) V332A probably damaging Het
Lrrc27 A G 7: 138,822,661 (GRCm39) I517M probably damaging Het
Mas1 T C 17: 13,061,106 (GRCm39) T106A probably benign Het
Mast4 T A 13: 102,887,932 (GRCm39) Y1159F possibly damaging Het
Mmp2 A G 8: 93,576,780 (GRCm39) D601G probably damaging Het
Mycbp2 T A 14: 103,434,793 (GRCm39) I2217F probably damaging Het
Mycbp2 A G 14: 103,393,889 (GRCm39) S2891P probably damaging Het
Naip6 A G 13: 100,437,209 (GRCm39) V438A possibly damaging Het
Or4g17 A G 2: 111,209,738 (GRCm39) H131R not run Het
Pdf T C 8: 107,775,173 (GRCm39) R20G probably benign Het
Pfdn2 T C 1: 171,184,162 (GRCm39) L47P probably damaging Het
Pik3c2g C A 6: 139,841,981 (GRCm39) N795K Het
Ppip5k1 A T 2: 121,142,450 (GRCm39) V1333D probably damaging Het
Pramel51 T C 12: 88,143,187 (GRCm39) T339A possibly damaging Het
Prss44 A T 9: 110,644,530 (GRCm39) I213F probably damaging Het
Rbm47 A G 5: 66,183,557 (GRCm39) Y349H probably damaging Het
Rcl1 A T 19: 29,108,096 (GRCm39) T253S probably benign Het
Rdh1 A G 10: 127,595,754 (GRCm39) probably benign Het
Scn7a C T 2: 66,522,898 (GRCm39) W935* probably null Het
Sec24b T C 3: 129,835,042 (GRCm39) N52S probably benign Het
Serpinb5 A T 1: 106,800,091 (GRCm39) I94L probably benign Het
Setx T C 2: 29,036,638 (GRCm39) V1041A probably benign Het
Slco3a1 G A 7: 73,968,232 (GRCm39) A496V possibly damaging Het
Spag5 T A 11: 78,204,205 (GRCm39) L486* probably null Het
Spink5 T C 18: 44,115,317 (GRCm39) I183T probably damaging Het
Srd5a1 T C 13: 69,759,173 (GRCm39) Y65C probably benign Het
Ssh2 T A 11: 77,344,349 (GRCm39) I778N possibly damaging Het
Sstr1 C T 12: 58,260,172 (GRCm39) S265L probably damaging Het
Syne2 T A 12: 76,014,529 (GRCm39) probably null Het
Tctn1 A T 5: 122,399,547 (GRCm39) D92E probably damaging Het
Tiam2 A G 17: 3,503,644 (GRCm39) I940M probably damaging Het
Tmeff2 T C 1: 51,018,599 (GRCm39) W194R unknown Het
Tomm20 T C 8: 127,663,903 (GRCm39) T94A probably benign Het
Ucn2 A G 9: 108,815,532 (GRCm39) N98S probably benign Het
V1rd19 A T 7: 23,702,743 (GRCm39) I70L probably benign Het
Vmn1r18 A G 6: 57,367,503 (GRCm39) L17P probably benign Het
Vmn2r61 A G 7: 41,909,534 (GRCm39) T20A probably benign Het
Wdr59 G A 8: 112,220,986 (GRCm39) T182I Het
Zfp40 A T 17: 23,395,155 (GRCm39) C477* probably null Het
Zfp68 A G 5: 138,604,830 (GRCm39) S498P possibly damaging Het
Zfp729b T C 13: 67,757,755 (GRCm39) probably null Het
Zfp846 T G 9: 20,505,521 (GRCm39) N460K probably benign Het
Zim1 T C 7: 6,680,352 (GRCm39) Y437C probably damaging Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTACTCCCGATAAAGCACTC -3'
(R):5'- TGGGAATTCACTTGTGGCCC -3'

Sequencing Primer
(F):5'- TTACCGCCATCACCTCTCACAG -3'
(R):5'- GGAATTCACTTGTGGCCCTTCATG -3'
Posted On 2019-09-13