Incidental Mutation 'R7332:Pik3c2g'
ID 569295
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7332 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139587221-139969284 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 139896255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 795 (N795K)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: N427K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: N427K

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: N795K

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
R8888:Pik3c2g UTSW 6 139730366 nonsense probably null
R8931:Pik3c2g UTSW 6 139875367 missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139622403 missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139875435 missense
R9383:Pik3c2g UTSW 6 139882016 nonsense probably null
R9524:Pik3c2g UTSW 6 139629770 missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139896200 missense
R9630:Pik3c2g UTSW 6 139622239 missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139967791 missense unknown
R9708:Pik3c2g UTSW 6 139629867 missense probably benign
R9717:Pik3c2g UTSW 6 139896184 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGGAGTGTTTCCCAGTG -3'
(R):5'- ACAGTGCCTAATTTCTGCTGTC -3'

Sequencing Primer
(F):5'- CCAGTGAAATTGAATAACCTGATCC -3'
(R):5'- GGCACTTCTTCAGTTGTAAC -3'
Posted On 2019-09-13