Mutagenetix > Incidental Mutations

Incidental Mutation 'R7332:Pik3c2g'

569295

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R7332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 139896255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 795 (N795K)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087657
AA Change: N427K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: N427K

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: N795K

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l2	A	G	19: 56,918,121	S449P	probably damaging	Het
Atp6v0c	A	C	17: 24,169,224	S21A	probably benign	Het
Cacna1e	T	C	1: 154,725,801	Y40C	possibly damaging	Het
Cdadc1	A	G	14: 59,575,764	I398T	possibly damaging	Het
Cfap44	T	A	16: 44,429,828	D756E	probably damaging	Het
Clcnkb	A	T	4: 141,413,932	L104Q	probably null	Het
Clk1	G	A	1: 58,412,694	H421Y	probably benign	Het
Cmpk2	A	T	12: 26,478,062	D426V	probably damaging	Het
Cmya5	A	G	13: 93,092,553	L2009S	possibly damaging	Het
Col5a2	C	G	1: 45,380,165	D1252H	probably damaging	Het
Coro1b	A	G	19: 4,149,357	K5R	probably benign	Het
Csmd2	A	G	4: 128,419,567	T1346A		Het
Csrp1	G	T	1: 135,739,411	W4L	probably benign	Het
Cyp3a25	A	G	5: 145,993,007	I184T	probably damaging	Het
Egfl7	C	A	2: 26,590,713	R128S	probably benign	Het
Fggy	A	T	4: 95,623,482	N157I	probably damaging	Het
Gldc	A	T	19: 30,116,526	L697Q	probably damaging	Het
Gm10436	T	C	12: 88,176,417	T339A	possibly damaging	Het
Gm4952	T	A	19: 12,627,009	Y262N	probably damaging	Het
Gsap	T	A	5: 21,290,121	M821K	probably benign	Het
Hps1	T	C	19: 42,777,912		probably null	Het
Hsbp1l1	T	C	18: 80,236,823		probably benign	Het
Igfbp7	G	A	5: 77,351,956	T220I	probably damaging	Het
Ints3	T	C	3: 90,415,512	Q137R	probably damaging	Het
Kcna6	A	G	6: 126,739,329	F199S	possibly damaging	Het
Kirrel	T	C	3: 87,088,398	I410V	probably benign	Het
Llgl2	T	C	11: 115,848,299	V332A	probably damaging	Het
Lrrc27	A	G	7: 139,242,745	I517M	probably damaging	Het
Mas1	T	C	17: 12,842,219	T106A	probably benign	Het
Mast4	T	A	13: 102,751,424	Y1159F	possibly damaging	Het
Mmp2	A	G	8: 92,850,152	D601G	probably damaging	Het
Mycbp2	A	G	14: 103,156,453	S2891P	probably damaging	Het
Mycbp2	T	A	14: 103,197,357	I2217F	probably damaging	Het
Naip6	A	G	13: 100,300,701	V438A	possibly damaging	Het
Olfr1284	A	G	2: 111,379,393	H131R	not run	Het
Pdf	T	C	8: 107,048,541	R20G	probably benign	Het
Pfdn2	T	C	1: 171,356,594	L47P	probably damaging	Het
Ppip5k1	A	T	2: 121,311,969	V1333D	probably damaging	Het
Prss44	A	T	9: 110,815,462	I213F	probably damaging	Het
Rbm47	A	G	5: 66,026,214	Y349H	probably damaging	Het
Rcl1	A	T	19: 29,130,696	T253S	probably benign	Het
Rdh1	A	G	10: 127,759,885		probably benign	Het
Scn7a	C	T	2: 66,692,554	W935*	probably null	Het
Sec24b	T	C	3: 130,041,393	N52S	probably benign	Het
Serpinb5	A	T	1: 106,872,361	I94L	probably benign	Het
Setx	T	C	2: 29,146,626	V1041A	probably benign	Het
Slco3a1	G	A	7: 74,318,484	A496V	possibly damaging	Het
Spag5	T	A	11: 78,313,379	L486*	probably null	Het
Spink5	T	C	18: 43,982,250	I183T	probably damaging	Het
Srd5a1	T	C	13: 69,611,054	Y65C	probably benign	Het
Ssh2	T	A	11: 77,453,523	I778N	possibly damaging	Het
Sstr1	C	T	12: 58,213,386	S265L	probably damaging	Het
Syne2	T	A	12: 75,967,755		probably null	Het
Tctn1	A	T	5: 122,261,484	D92E	probably damaging	Het
Tiam2	A	G	17: 3,453,369	I940M	probably damaging	Het
Tmeff2	T	C	1: 50,979,440	W194R	unknown	Het
Tomm20	T	C	8: 126,937,153	T94A	probably benign	Het
Ucn2	A	G	9: 108,986,464	N98S	probably benign	Het
V1rd19	A	T	7: 24,003,318	I70L	probably benign	Het
Vmn1r18	A	G	6: 57,390,518	L17P	probably benign	Het
Vmn2r61	A	G	7: 42,260,110	T20A	probably benign	Het
Wdr59	G	A	8: 111,494,354	T182I		Het
Zfp40	A	T	17: 23,176,181	C477*	probably null	Het
Zfp68	A	G	5: 138,606,568	S498P	possibly damaging	Het
Zfp729b	T	C	13: 67,609,636		probably null	Het
Zfp846	T	G	9: 20,594,225	N460K	probably benign	Het
Zim1	T	C	7: 6,677,353	Y437C	probably damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCTGGAGTGTTTCCCAGTG -3'
(R):5'- ACAGTGCCTAATTTCTGCTGTC -3'

Sequencing Primer
(F):5'- CCAGTGAAATTGAATAACCTGATCC -3'
(R):5'- GGCACTTCTTCAGTTGTAAC -3'

Posted On

2019-09-13