Incidental Mutation 'R7332:Pik3c2g'
ID 569295
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 045425-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7332 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 139841981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 795 (N795K)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: N427K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: N427K

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: N795K

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,906,553 (GRCm39) S449P probably damaging Het
Atp6v0c A C 17: 24,388,198 (GRCm39) S21A probably benign Het
Cacna1e T C 1: 154,601,547 (GRCm39) Y40C possibly damaging Het
Cdadc1 A G 14: 59,813,213 (GRCm39) I398T possibly damaging Het
Cfap44 T A 16: 44,250,191 (GRCm39) D756E probably damaging Het
Clcnkb A T 4: 141,141,243 (GRCm39) L104Q probably null Het
Clk1 G A 1: 58,451,853 (GRCm39) H421Y probably benign Het
Cmpk2 A T 12: 26,528,061 (GRCm39) D426V probably damaging Het
Cmya5 A G 13: 93,229,061 (GRCm39) L2009S possibly damaging Het
Col5a2 C G 1: 45,419,325 (GRCm39) D1252H probably damaging Het
Coro1b A G 19: 4,199,356 (GRCm39) K5R probably benign Het
Csmd2 A G 4: 128,313,360 (GRCm39) T1346A Het
Csrp1 G T 1: 135,667,149 (GRCm39) W4L probably benign Het
Cyp3a25 A G 5: 145,929,817 (GRCm39) I184T probably damaging Het
Egfl7 C A 2: 26,480,725 (GRCm39) R128S probably benign Het
Fggy A T 4: 95,511,719 (GRCm39) N157I probably damaging Het
Gldc A T 19: 30,093,926 (GRCm39) L697Q probably damaging Het
Gm4952 T A 19: 12,604,373 (GRCm39) Y262N probably damaging Het
Gsap T A 5: 21,495,119 (GRCm39) M821K probably benign Het
Hps1 T C 19: 42,766,351 (GRCm39) probably null Het
Hsbp1l1 T C 18: 80,280,038 (GRCm39) probably benign Het
Igfbp7 G A 5: 77,499,803 (GRCm39) T220I probably damaging Het
Ints3 T C 3: 90,322,819 (GRCm39) Q137R probably damaging Het
Kcna6 A G 6: 126,716,292 (GRCm39) F199S possibly damaging Het
Kirrel1 T C 3: 86,995,705 (GRCm39) I410V probably benign Het
Llgl2 T C 11: 115,739,125 (GRCm39) V332A probably damaging Het
Lrrc27 A G 7: 138,822,661 (GRCm39) I517M probably damaging Het
Mas1 T C 17: 13,061,106 (GRCm39) T106A probably benign Het
Mast4 T A 13: 102,887,932 (GRCm39) Y1159F possibly damaging Het
Mmp2 A G 8: 93,576,780 (GRCm39) D601G probably damaging Het
Mycbp2 T A 14: 103,434,793 (GRCm39) I2217F probably damaging Het
Mycbp2 A G 14: 103,393,889 (GRCm39) S2891P probably damaging Het
Naip6 A G 13: 100,437,209 (GRCm39) V438A possibly damaging Het
Or4g17 A G 2: 111,209,738 (GRCm39) H131R not run Het
Pdf T C 8: 107,775,173 (GRCm39) R20G probably benign Het
Pfdn2 T C 1: 171,184,162 (GRCm39) L47P probably damaging Het
Ppip5k1 A T 2: 121,142,450 (GRCm39) V1333D probably damaging Het
Pramel51 T C 12: 88,143,187 (GRCm39) T339A possibly damaging Het
Prss44 A T 9: 110,644,530 (GRCm39) I213F probably damaging Het
Rbm47 A G 5: 66,183,557 (GRCm39) Y349H probably damaging Het
Rcl1 A T 19: 29,108,096 (GRCm39) T253S probably benign Het
Rdh1 A G 10: 127,595,754 (GRCm39) probably benign Het
Scn7a C T 2: 66,522,898 (GRCm39) W935* probably null Het
Sec24b T C 3: 129,835,042 (GRCm39) N52S probably benign Het
Serpinb5 A T 1: 106,800,091 (GRCm39) I94L probably benign Het
Setx T C 2: 29,036,638 (GRCm39) V1041A probably benign Het
Slco3a1 G A 7: 73,968,232 (GRCm39) A496V possibly damaging Het
Spag5 T A 11: 78,204,205 (GRCm39) L486* probably null Het
Spink5 T C 18: 44,115,317 (GRCm39) I183T probably damaging Het
Srd5a1 T C 13: 69,759,173 (GRCm39) Y65C probably benign Het
Ssh2 T A 11: 77,344,349 (GRCm39) I778N possibly damaging Het
Sstr1 C T 12: 58,260,172 (GRCm39) S265L probably damaging Het
Syne2 T A 12: 76,014,529 (GRCm39) probably null Het
Tctn1 A T 5: 122,399,547 (GRCm39) D92E probably damaging Het
Tiam2 A G 17: 3,503,644 (GRCm39) I940M probably damaging Het
Tmeff2 T C 1: 51,018,599 (GRCm39) W194R unknown Het
Tomm20 T C 8: 127,663,903 (GRCm39) T94A probably benign Het
Ucn2 A G 9: 108,815,532 (GRCm39) N98S probably benign Het
V1rd19 A T 7: 23,702,743 (GRCm39) I70L probably benign Het
Vmn1r18 A G 6: 57,367,503 (GRCm39) L17P probably benign Het
Vmn2r61 A G 7: 41,909,534 (GRCm39) T20A probably benign Het
Wdr59 G A 8: 112,220,986 (GRCm39) T182I Het
Zfp40 A T 17: 23,395,155 (GRCm39) C477* probably null Het
Zfp68 A G 5: 138,604,830 (GRCm39) S498P possibly damaging Het
Zfp729b T C 13: 67,757,755 (GRCm39) probably null Het
Zfp846 T G 9: 20,505,521 (GRCm39) N460K probably benign Het
Zim1 T C 7: 6,680,352 (GRCm39) Y437C probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139,599,546 (GRCm39) missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,842,518 (GRCm39) missense probably damaging 1.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139,903,502 (GRCm39) missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9524:Pik3c2g UTSW 6 139,606,768 (GRCm39) missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF015:Pik3c2g UTSW 6 139,700,497 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGGAGTGTTTCCCAGTG -3'
(R):5'- ACAGTGCCTAATTTCTGCTGTC -3'

Sequencing Primer
(F):5'- CCAGTGAAATTGAATAACCTGATCC -3'
(R):5'- GGCACTTCTTCAGTTGTAAC -3'
Posted On 2019-09-13