Incidental Mutation 'R7332:Zim1'
ID 569296
Institutional Source Beutler Lab
Gene Symbol Zim1
Ensembl Gene ENSMUSG00000002266
Gene Name zinc finger, imprinted 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7332 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 6671269-6696450 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6677353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 437 (Y437C)
Ref Sequence ENSEMBL: ENSMUSP00000002336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002336] [ENSMUST00000122432] [ENSMUST00000203908]
AlphaFold Q8C393
Predicted Effect probably damaging
Transcript: ENSMUST00000002336
AA Change: Y437C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002336
Gene: ENSMUSG00000002266
AA Change: Y437C

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122432
AA Change: Y437C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113585
Gene: ENSMUSG00000002266
AA Change: Y437C

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203908
AA Change: Y437C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145453
Gene: ENSMUSG00000002266
AA Change: Y437C

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Other mutations in Zim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Zim1 APN 7 6682760 missense possibly damaging 0.95
IGL01921:Zim1 APN 7 6682185 splice site probably benign
IGL02116:Zim1 APN 7 6678254 missense probably benign 0.00
IGL02252:Zim1 APN 7 6688628 missense unknown
IGL02354:Zim1 APN 7 6682874 splice site probably null
IGL02361:Zim1 APN 7 6682874 splice site probably null
IGL03025:Zim1 APN 7 6682059 missense probably benign 0.00
R0003:Zim1 UTSW 7 6676948 missense probably benign 0.01
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1483:Zim1 UTSW 7 6682125 missense probably benign 0.00
R2106:Zim1 UTSW 7 6678074 missense probably benign 0.02
R2315:Zim1 UTSW 7 6677068 missense possibly damaging 0.86
R2508:Zim1 UTSW 7 6677430 small insertion probably benign
R2508:Zim1 UTSW 7 6677431 small insertion probably benign
R3706:Zim1 UTSW 7 6677291 missense probably damaging 0.97
R3975:Zim1 UTSW 7 6677130 missense probably damaging 1.00
R5524:Zim1 UTSW 7 6677321 missense probably benign 0.34
R5557:Zim1 UTSW 7 6677711 missense probably damaging 1.00
R5843:Zim1 UTSW 7 6677698 missense possibly damaging 0.59
R5844:Zim1 UTSW 7 6678116 missense probably benign 0.21
R5882:Zim1 UTSW 7 6682738 critical splice donor site probably null
R6828:Zim1 UTSW 7 6677689 missense probably damaging 1.00
R6953:Zim1 UTSW 7 6687707 missense unknown
R7080:Zim1 UTSW 7 6677306 missense possibly damaging 0.92
R7148:Zim1 UTSW 7 6678221 missense possibly damaging 0.91
R7199:Zim1 UTSW 7 6677873 nonsense probably null
R7462:Zim1 UTSW 7 6677812 missense probably damaging 1.00
R8350:Zim1 UTSW 7 6682065 missense probably damaging 0.99
R9480:Zim1 UTSW 7 6678051 missense probably benign 0.20
R9510:Zim1 UTSW 7 6687740 nonsense probably null
R9761:Zim1 UTSW 7 6677772 missense probably damaging 1.00
Z1088:Zim1 UTSW 7 6677659 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TACCTGGAGTTTGCCTCGTG -3'
(R):5'- TGCGGGAAAACCTTCAACC -3'

Sequencing Primer
(F):5'- GGAGTTTGCCTCGTGTCTCTTC -3'
(R):5'- ACCCTTTAAATGTGACGAGTGCG -3'
Posted On 2019-09-13