Incidental Mutation 'R7332:Vmn2r61'
ID569298
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42260110 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably benign
Transcript: ENSMUST00000166131
AA Change: T20A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: T20A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0319:Vmn2r61 UTSW 7 42300517 missense probably damaging 0.99
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTGCACTCATTAACAGTCAG -3'
(R):5'- CTGGTGTTACATGCATGACAAAG -3'

Sequencing Primer
(F):5'- TGCACTCATTAACAGTCAGAATCAC -3'
(R):5'- CCTTTTACAGAGGAAAAGAAGTCAAC -3'
Posted On2019-09-13