Incidental Mutation 'R7332:Lrrc27'
ID569300
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Nameleucine rich repeat containing 27
Synonyms1700071K18Rik, 2310044E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139212988-139242979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139242745 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 517 (I517M)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124]
Predicted Effect probably damaging
Transcript: ENSMUST00000016124
AA Change: I517M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: I517M

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 139227911 intron probably benign
IGL02095:Lrrc27 APN 7 139230253 missense probably benign 0.04
IGL02489:Lrrc27 APN 7 139226061 missense probably benign 0.01
IGL03080:Lrrc27 APN 7 139230237 missense probably benign 0.03
R0372:Lrrc27 UTSW 7 139226187 missense probably benign 0.17
R1466:Lrrc27 UTSW 7 139230308 unclassified probably benign
R2401:Lrrc27 UTSW 7 139223613 missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 139228684 intron probably benign
R3113:Lrrc27 UTSW 7 139218307 missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 139223693 missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R4784:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R5070:Lrrc27 UTSW 7 139214799 missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 139218335 unclassified probably benign
R6408:Lrrc27 UTSW 7 139218268 missense probably benign 0.14
R6993:Lrrc27 UTSW 7 139242624 missense probably damaging 0.99
R7350:Lrrc27 UTSW 7 139226106 missense probably benign 0.01
R7460:Lrrc27 UTSW 7 139223658 missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 139214832 missense probably benign
R8020:Lrrc27 UTSW 7 139236877 missense probably damaging 1.00
RF018:Lrrc27 UTSW 7 139226100 missense probably benign 0.03
X0065:Lrrc27 UTSW 7 139230245 missense probably benign 0.00
X0065:Lrrc27 UTSW 7 139230246 missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 139242720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATATGCACCGAAGTAGGGG -3'
(R):5'- TGCAGCTAAACCTTCTATAGCCTC -3'

Sequencing Primer
(F):5'- CACCGAAGTAGGGGTTCATTTGTC -3'
(R):5'- GCTAAACCTTCTATAGCCTCAGGAAG -3'
Posted On2019-09-13