Mutagenetix > Incidental Mutation

Incidental Mutation 'R7332:Spag5'

569310

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 78313379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 486 (L486*)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

probably null
Transcript: ENSMUST00000045026
AA Change: L486*

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: L486*

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l2	A	G	19: 56,918,121	S449P	probably damaging	Het
Atp6v0c	A	C	17: 24,169,224	S21A	probably benign	Het
Cacna1e	T	C	1: 154,725,801	Y40C	possibly damaging	Het
Cdadc1	A	G	14: 59,575,764	I398T	possibly damaging	Het
Cfap44	T	A	16: 44,429,828	D756E	probably damaging	Het
Clcnkb	A	T	4: 141,413,932	L104Q	probably null	Het
Clk1	G	A	1: 58,412,694	H421Y	probably benign	Het
Cmpk2	A	T	12: 26,478,062	D426V	probably damaging	Het
Cmya5	A	G	13: 93,092,553	L2009S	possibly damaging	Het
Col5a2	C	G	1: 45,380,165	D1252H	probably damaging	Het
Coro1b	A	G	19: 4,149,357	K5R	probably benign	Het
Csmd2	A	G	4: 128,419,567	T1346A		Het
Csrp1	G	T	1: 135,739,411	W4L	probably benign	Het
Cyp3a25	A	G	5: 145,993,007	I184T	probably damaging	Het
Egfl7	C	A	2: 26,590,713	R128S	probably benign	Het
Fggy	A	T	4: 95,623,482	N157I	probably damaging	Het
Gldc	A	T	19: 30,116,526	L697Q	probably damaging	Het
Gm10436	T	C	12: 88,176,417	T339A	possibly damaging	Het
Gm4952	T	A	19: 12,627,009	Y262N	probably damaging	Het
Gsap	T	A	5: 21,290,121	M821K	probably benign	Het
Hps1	T	C	19: 42,777,912		probably null	Het
Hsbp1l1	T	C	18: 80,236,823		probably benign	Het
Igfbp7	G	A	5: 77,351,956	T220I	probably damaging	Het
Ints3	T	C	3: 90,415,512	Q137R	probably damaging	Het
Kcna6	A	G	6: 126,739,329	F199S	possibly damaging	Het
Kirrel	T	C	3: 87,088,398	I410V	probably benign	Het
Llgl2	T	C	11: 115,848,299	V332A	probably damaging	Het
Lrrc27	A	G	7: 139,242,745	I517M	probably damaging	Het
Mas1	T	C	17: 12,842,219	T106A	probably benign	Het
Mast4	T	A	13: 102,751,424	Y1159F	possibly damaging	Het
Mmp2	A	G	8: 92,850,152	D601G	probably damaging	Het
Mycbp2	A	G	14: 103,156,453	S2891P	probably damaging	Het
Mycbp2	T	A	14: 103,197,357	I2217F	probably damaging	Het
Naip6	A	G	13: 100,300,701	V438A	possibly damaging	Het
Olfr1284	A	G	2: 111,379,393	H131R	not run	Het
Pdf	T	C	8: 107,048,541	R20G	probably benign	Het
Pfdn2	T	C	1: 171,356,594	L47P	probably damaging	Het
Pik3c2g	C	A	6: 139,896,255	N795K		Het
Ppip5k1	A	T	2: 121,311,969	V1333D	probably damaging	Het
Prss44	A	T	9: 110,815,462	I213F	probably damaging	Het
Rbm47	A	G	5: 66,026,214	Y349H	probably damaging	Het
Rcl1	A	T	19: 29,130,696	T253S	probably benign	Het
Rdh1	A	G	10: 127,759,885		probably benign	Het
Scn7a	C	T	2: 66,692,554	W935*	probably null	Het
Sec24b	T	C	3: 130,041,393	N52S	probably benign	Het
Serpinb5	A	T	1: 106,872,361	I94L	probably benign	Het
Setx	T	C	2: 29,146,626	V1041A	probably benign	Het
Slco3a1	G	A	7: 74,318,484	A496V	possibly damaging	Het
Spink5	T	C	18: 43,982,250	I183T	probably damaging	Het
Srd5a1	T	C	13: 69,611,054	Y65C	probably benign	Het
Ssh2	T	A	11: 77,453,523	I778N	possibly damaging	Het
Sstr1	C	T	12: 58,213,386	S265L	probably damaging	Het
Syne2	T	A	12: 75,967,755		probably null	Het
Tctn1	A	T	5: 122,261,484	D92E	probably damaging	Het
Tiam2	A	G	17: 3,453,369	I940M	probably damaging	Het
Tmeff2	T	C	1: 50,979,440	W194R	unknown	Het
Tomm20	T	C	8: 126,937,153	T94A	probably benign	Het
Ucn2	A	G	9: 108,986,464	N98S	probably benign	Het
V1rd19	A	T	7: 24,003,318	I70L	probably benign	Het
Vmn1r18	A	G	6: 57,390,518	L17P	probably benign	Het
Vmn2r61	A	G	7: 42,260,110	T20A	probably benign	Het
Wdr59	G	A	8: 111,494,354	T182I		Het
Zfp40	A	T	17: 23,176,181	C477*	probably null	Het
Zfp68	A	G	5: 138,606,568	S498P	possibly damaging	Het
Zfp729b	T	C	13: 67,609,636		probably null	Het
Zfp846	T	G	9: 20,594,225	N460K	probably benign	Het
Zim1	T	C	7: 6,677,353	Y437C	probably damaging	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AGACAGGCTCTACTGCAAGC -3'
(R):5'- TTCTTCAGCACACGAGAACAGG -3'

Sequencing Primer
(F):5'- CTACTGCAAGCCAGGAATGTCATG -3'
(R):5'- GAGGAAACCAGGGTTTTTGACC -3'

Posted On

2019-09-13