Mutagenetix > Incidental Mutation

Incidental Mutation 'R0639:Lrig3'

56932

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

038828-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R0639 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 126010221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 840 (C840G)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074807
AA Change: C840G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: C840G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	C	T	17: 45,733,073	W86*	probably null	Het
5830411N06Rik	A	G	7: 140,247,959	N27D	probably benign	Het
Acadl	T	C	1: 66,857,408	H75R	probably benign	Het
Adamtsl1	T	C	4: 86,277,143	F599S	probably damaging	Het
Adrb3	T	C	8: 27,228,265	N52S	probably damaging	Het
Agbl3	T	A	6: 34,799,705	L377Q	probably damaging	Het
Akap9	T	C	5: 4,060,318	L3007P	probably damaging	Het
Amer3	T	A	1: 34,587,821	Y380*	probably null	Het
Ankrd13d	A	T	19: 4,273,019		probably null	Het
Ap4m1	T	A	5: 138,176,239	C235S	probably benign	Het
Arhgap29	T	C	3: 122,007,641	F675S	probably damaging	Het
Asah2	C	A	19: 32,008,639	V544F	probably damaging	Het
Ash2l	A	G	8: 25,823,291	I389T	possibly damaging	Het
Bend5	T	C	4: 111,433,298	S164P	probably benign	Het
Cacna1d	A	G	14: 30,171,294		probably null	Het
Cdc25b	A	G	2: 131,197,262	N516D	probably benign	Het
Cdc27	A	G	11: 104,531,734	Y125H	probably damaging	Het
Cdk5r2	C	T	1: 74,855,836	L247F	probably damaging	Het
Cenpf	C	A	1: 189,658,062	G1191V	probably benign	Het
Cops4	C	T	5: 100,537,460	T293I	possibly damaging	Het
Csmd3	A	G	15: 47,913,940	L1294P	probably damaging	Het
Dclre1a	T	C	19: 56,538,440	Y848C	probably damaging	Het
Disp2	A	T	2: 118,790,844	I686F	possibly damaging	Het
Dnah6	T	A	6: 73,022,412	Y4012F	probably benign	Het
Dnajc11	C	G	4: 151,969,936	R200G	probably damaging	Het
Dnhd1	A	T	7: 105,696,464	D2272V	possibly damaging	Het
Elane	A	C	10: 79,886,349	R5S	possibly damaging	Het
Entpd7	G	A	19: 43,691,094	V29M	probably benign	Het
Fanca	A	G	8: 123,289,359		probably null	Het
Fgl1	G	T	8: 41,191,624	T281K	probably benign	Het
Flii	T	C	11: 60,722,997		probably null	Het
Foxn1	T	C	11: 78,371,144	D133G	possibly damaging	Het
Fzd7	T	A	1: 59,484,560	M534K	probably damaging	Het
Galnt5	A	G	2: 57,999,395	T336A	probably benign	Het
Gli3	G	A	13: 15,724,715	D896N	probably damaging	Het
Gsx1	G	T	5: 147,189,946	W193L	probably damaging	Het
Gtpbp3	A	T	8: 71,492,735	I485F	probably damaging	Het
H2-M11	A	G	17: 36,547,391	T26A	probably benign	Het
Igfbp7	T	C	5: 77,351,980	D243G	probably damaging	Het
Il31ra	A	T	13: 112,525,843	D477E	possibly damaging	Het
Inmt	A	C	6: 55,171,227	V139G	probably damaging	Het
Inpp5j	T	A	11: 3,501,147	M501L	probably benign	Het
Itsn2	T	C	12: 4,712,556	F1579L	probably damaging	Het
Kat2b	C	A	17: 53,567,538	A70E	probably benign	Het
Klhl20	T	C	1: 161,093,711	E58G	probably damaging	Het
Krt79	A	T	15: 101,931,548	Y337*	probably null	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Letm1	T	C	5: 33,769,426	I176V	possibly damaging	Het
Lingo3	C	A	10: 80,835,784	R104L	probably benign	Het
Lrrc9	A	G	12: 72,486,288	N977S	probably damaging	Het
Lrrk2	T	A	15: 91,772,996	M1831K	probably benign	Het
Mn1	A	T	5: 111,419,316	D384V	probably damaging	Het
Morc3	C	A	16: 93,853,850	H319Q	probably damaging	Het
Morn1	T	C	4: 155,089,503	F56L	possibly damaging	Het
Mrpl53	G	T	6: 83,109,411	V64L	probably damaging	Het
Myo15	T	A	11: 60,479,336	V974D	probably benign	Het
Neb	A	G	2: 52,256,124	V2947A	possibly damaging	Het
Nfasc	A	C	1: 132,603,816	N737K	probably damaging	Het
Nlk	T	C	11: 78,572,277	D464G	possibly damaging	Het
Nlrc4	C	T	17: 74,426,963	R985K	probably benign	Het
Nsun6	T	C	2: 14,996,336	K470E	probably benign	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Olfr887	G	A	9: 38,085,370	C178Y	probably damaging	Het
Otop1	T	C	5: 38,287,948	V150A	possibly damaging	Het
Pclo	C	T	5: 14,681,749	R296*	probably null	Het
Pdzd2	A	T	15: 12,458,058	C240S	possibly damaging	Het
Plekhg5	A	G	4: 152,114,120	T922A	probably benign	Het
Plekhm2	A	C	4: 141,642,070	L101R	probably damaging	Het
Plscr3	T	A	11: 69,847,994	C161S	probably benign	Het
Prr14l	C	T	5: 32,828,915	D1079N	probably benign	Het
Ptpru	A	T	4: 131,771,179	V1377E	possibly damaging	Het
Rab37	C	A	11: 115,158,702	D112E	probably benign	Het
Raet1e	T	A	10: 22,174,375	I19N	probably damaging	Het
Rassf5	T	C	1: 131,245,066	Y22C	probably damaging	Het
Rp1	T	C	1: 4,346,498	T1464A	probably benign	Het
Safb	T	A	17: 56,601,092		probably benign	Het
Scarf2	A	G	16: 17,806,505		probably null	Het
Sh3d19	T	C	3: 86,106,973	S415P	probably benign	Het
Slc26a9	T	A	1: 131,763,804	L595Q	probably damaging	Het
Slc4a8	T	C	15: 100,796,550	Y470H	probably damaging	Het
Slitrk3	T	C	3: 73,049,649	N597D	probably benign	Het
Spata31	T	A	13: 64,922,213	V725E	probably benign	Het
Spink12	T	A	18: 44,107,764	C72*	probably null	Het
Spink5	T	A	18: 44,012,975		probably null	Het
Stk40	C	A	4: 126,118,332	S9*	probably null	Het
Sypl	A	T	12: 32,965,421	T40S	probably damaging	Het
Tbc1d8	C	T	1: 39,391,209	E438K	probably benign	Het
Tdrd7	A	G	4: 45,989,102	T111A	probably benign	Het
Tg	A	T	15: 66,741,484		probably null	Het
Tlr5	T	A	1: 182,973,889	W253R	probably damaging	Het
Tmprss11c	C	T	5: 86,235,469	C353Y	probably damaging	Het
Tnfrsf8	T	A	4: 145,288,027	M271L	probably benign	Het
Toe1	T	C	4: 116,806,750	N21S	probably benign	Het
Tpp2	T	C	1: 43,975,447	F649L	probably benign	Het
Ttll1	G	A	15: 83,502,225	Q60*	probably null	Het
Vcp	C	T	4: 42,982,565	R709Q	probably benign	Het
Vmn1r119	T	A	7: 21,011,668	H263L	possibly damaging	Het
Vmn1r195	C	A	13: 22,278,941	Q194K	probably damaging	Het
Vmn1r33	T	C	6: 66,611,799	Y257C	probably damaging	Het
Vmn2r15	A	G	5: 109,293,015	F326L	probably benign	Het
Wbp11	A	T	6: 136,816,110		probably benign	Het
Wwp2	T	G	8: 107,517,946	V250G	probably benign	Het
Xpnpep3	T	C	15: 81,430,837	V246A	probably benign	Het
Zcchc14	G	A	8: 121,605,449	R419*	probably null	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACGTTCGCCTCAGTGTGATCC -3'
(R):5'- GAAGGGCTACTTCACTCTGCTTGG -3'

Sequencing Primer
(F):5'- AGTGTGATCCCTACTCCGAC -3'
(R):5'- CCACCAGGAGTATCCTGATGAG -3'

Posted On

2013-07-11