Mutagenetix > Incidental Mutations

Incidental Mutation 'R7332:Spink5'

569328

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43982250 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 183 (I183T)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069245
AA Change: I183T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: I183T

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l2	A	G	19: 56,918,121	S449P	probably damaging	Het
Atp6v0c	A	C	17: 24,169,224	S21A	probably benign	Het
Cacna1e	T	C	1: 154,725,801	Y40C	possibly damaging	Het
Cdadc1	A	G	14: 59,575,764	I398T	possibly damaging	Het
Cfap44	T	A	16: 44,429,828	D756E	probably damaging	Het
Clcnkb	A	T	4: 141,413,932	L104Q	probably null	Het
Clk1	G	A	1: 58,412,694	H421Y	probably benign	Het
Cmpk2	A	T	12: 26,478,062	D426V	probably damaging	Het
Cmya5	A	G	13: 93,092,553	L2009S	possibly damaging	Het
Col5a2	C	G	1: 45,380,165	D1252H	probably damaging	Het
Coro1b	A	G	19: 4,149,357	K5R	probably benign	Het
Csmd2	A	G	4: 128,419,567	T1346A		Het
Csrp1	G	T	1: 135,739,411	W4L	probably benign	Het
Cyp3a25	A	G	5: 145,993,007	I184T	probably damaging	Het
Egfl7	C	A	2: 26,590,713	R128S	probably benign	Het
Fggy	A	T	4: 95,623,482	N157I	probably damaging	Het
Gldc	A	T	19: 30,116,526	L697Q	probably damaging	Het
Gm10436	T	C	12: 88,176,417	T339A	possibly damaging	Het
Gm4952	T	A	19: 12,627,009	Y262N	probably damaging	Het
Gsap	T	A	5: 21,290,121	M821K	probably benign	Het
Hps1	T	C	19: 42,777,912		probably null	Het
Hsbp1l1	T	C	18: 80,236,823		probably benign	Het
Igfbp7	G	A	5: 77,351,956	T220I	probably damaging	Het
Ints3	T	C	3: 90,415,512	Q137R	probably damaging	Het
Kcna6	A	G	6: 126,739,329	F199S	possibly damaging	Het
Kirrel	T	C	3: 87,088,398	I410V	probably benign	Het
Llgl2	T	C	11: 115,848,299	V332A	probably damaging	Het
Lrrc27	A	G	7: 139,242,745	I517M	probably damaging	Het
Mas1	T	C	17: 12,842,219	T106A	probably benign	Het
Mast4	T	A	13: 102,751,424	Y1159F	possibly damaging	Het
Mmp2	A	G	8: 92,850,152	D601G	probably damaging	Het
Mycbp2	A	G	14: 103,156,453	S2891P	probably damaging	Het
Mycbp2	T	A	14: 103,197,357	I2217F	probably damaging	Het
Naip6	A	G	13: 100,300,701	V438A	possibly damaging	Het
Olfr1284	A	G	2: 111,379,393	H131R	not run	Het
Pdf	T	C	8: 107,048,541	R20G	probably benign	Het
Pfdn2	T	C	1: 171,356,594	L47P	probably damaging	Het
Pik3c2g	C	A	6: 139,896,255	N795K		Het
Ppip5k1	A	T	2: 121,311,969	V1333D	probably damaging	Het
Prss44	A	T	9: 110,815,462	I213F	probably damaging	Het
Rbm47	A	G	5: 66,026,214	Y349H	probably damaging	Het
Rcl1	A	T	19: 29,130,696	T253S	probably benign	Het
Rdh1	A	G	10: 127,759,885		probably benign	Het
Scn7a	C	T	2: 66,692,554	W935*	probably null	Het
Sec24b	T	C	3: 130,041,393	N52S	probably benign	Het
Serpinb5	A	T	1: 106,872,361	I94L	probably benign	Het
Setx	T	C	2: 29,146,626	V1041A	probably benign	Het
Slco3a1	G	A	7: 74,318,484	A496V	possibly damaging	Het
Spag5	T	A	11: 78,313,379	L486*	probably null	Het
Srd5a1	T	C	13: 69,611,054	Y65C	probably benign	Het
Ssh2	T	A	11: 77,453,523	I778N	possibly damaging	Het
Sstr1	C	T	12: 58,213,386	S265L	probably damaging	Het
Syne2	T	A	12: 75,967,755		probably null	Het
Tctn1	A	T	5: 122,261,484	D92E	probably damaging	Het
Tiam2	A	G	17: 3,453,369	I940M	probably damaging	Het
Tmeff2	T	C	1: 50,979,440	W194R	unknown	Het
Tomm20	T	C	8: 126,937,153	T94A	probably benign	Het
Ucn2	A	G	9: 108,986,464	N98S	probably benign	Het
V1rd19	A	T	7: 24,003,318	I70L	probably benign	Het
Vmn1r18	A	G	6: 57,390,518	L17P	probably benign	Het
Vmn2r61	A	G	7: 42,260,110	T20A	probably benign	Het
Wdr59	G	A	8: 111,494,354	T182I		Het
Zfp40	A	T	17: 23,176,181	C477*	probably null	Het
Zfp68	A	G	5: 138,606,568	S498P	possibly damaging	Het
Zfp729b	T	C	13: 67,609,636		probably null	Het
Zfp846	T	G	9: 20,594,225	N460K	probably benign	Het
Zim1	T	C	7: 6,677,353	Y437C	probably damaging	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999935	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R7919:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7963:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGAGTGATCCACATGAGTTC -3'
(R):5'- TCATTACGAAGGCAAAAGGTCAC -3'

Sequencing Primer
(F):5'- CTTAGAGATGAATTACACAGACTCAC -3'
(R):5'- GCAAAAGGTCACATGCATCATG -3'

Posted On

2019-09-13