Incidental Mutation 'R7334:St18'
ID 569335
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 6802559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 173 (D173N)
Ref Sequence ENSEMBL: ENSMUSP00000042056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000139838] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably benign
Transcript: ENSMUST00000043578
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131494
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132207
Predicted Effect probably benign
Transcript: ENSMUST00000139838
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118129
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140079
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150761
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
AA Change: D173N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: D173N

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
R9603:St18 UTSW 1 6845587 missense probably damaging 1.00
R9611:St18 UTSW 1 6802923 missense probably benign 0.00
R9639:St18 UTSW 1 6859022 missense
R9644:St18 UTSW 1 6859052 missense
Predicted Primers PCR Primer
(F):5'- ACTCTTCATTTACCTGCACAAGAC -3'
(R):5'- ATCTCAGGAACTTCCAACAGGTC -3'

Sequencing Primer
(F):5'- TTCATTTACCTGCACAAGACAGCTC -3'
(R):5'- GGAACTTCCAACAGGTCCTTTC -3'
Posted On 2019-09-13