Incidental Mutation 'R7334:Thsd7b'
ID569339
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130195275 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1544 (W1544R)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: W1544R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: W1544R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130103153 missense probably benign 0.01
R7414:Thsd7b UTSW 1 129628980 missense probably damaging 0.99
R7683:Thsd7b UTSW 1 129595946 missense probably damaging 0.99
R7861:Thsd7b UTSW 1 130159698 missense probably benign 0.00
R7944:Thsd7b UTSW 1 130159698 missense probably benign 0.00
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129595516 missense not run
Z1176:Thsd7b UTSW 1 129595660 missense not run
Z1176:Thsd7b UTSW 1 129628911 missense not run
Z1176:Thsd7b UTSW 1 130180424 missense not run
Predicted Primers PCR Primer
(F):5'- ACTATAGGGAGGAGTCTGTGGC -3'
(R):5'- ACTGCCACTTAGACTGTGATTGAC -3'

Sequencing Primer
(F):5'- CTGTGGCTGTGAGAAGGGATACAC -3'
(R):5'- GCATCCATGAAAATGCTTTATGC -3'
Posted On2019-09-13