Incidental Mutation 'R7334:Bpifb3'
ID 569344
Institutional Source Beutler Lab
Gene Symbol Bpifb3
Ensembl Gene ENSMUSG00000068008
Gene Name BPI fold containing family B, member 3
Synonyms Rya3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 153918230-153932996 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 153919734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 34 (D34E)
Ref Sequence ENSEMBL: ENSMUSP00000086342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088950] [ENSMUST00000109760]
AlphaFold Q80ZU7
Predicted Effect probably damaging
Transcript: ENSMUST00000088950
AA Change: D34E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086342
Gene: ENSMUSG00000068008
AA Change: D34E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BPI1 30 272 3.22e-52 SMART
BPI2 271 471 1.4e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109760
AA Change: D34E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105382
Gene: ENSMUSG00000068008
AA Change: D34E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BPI1 30 272 3.22e-52 SMART
BPI2 271 471 1.4e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Bpifb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Bpifb3 APN 2 153925601 missense probably benign 0.42
IGL02568:Bpifb3 APN 2 153924801 missense probably benign 0.02
IGL02817:Bpifb3 APN 2 153919646 missense unknown
IGL03175:Bpifb3 APN 2 153919648 missense unknown
R0478:Bpifb3 UTSW 2 153931480 splice site probably benign
R0538:Bpifb3 UTSW 2 153923869 missense probably benign 0.05
R1633:Bpifb3 UTSW 2 153922584 missense probably damaging 1.00
R1850:Bpifb3 UTSW 2 153929344 missense possibly damaging 0.69
R1874:Bpifb3 UTSW 2 153925840 missense probably benign 0.01
R5993:Bpifb3 UTSW 2 153929314 missense probably benign 0.20
R6120:Bpifb3 UTSW 2 153931443 missense probably benign 0.12
R6170:Bpifb3 UTSW 2 153919637 missense unknown
R6216:Bpifb3 UTSW 2 153925853 missense probably benign 0.17
R6274:Bpifb3 UTSW 2 153929323 missense possibly damaging 0.87
R6431:Bpifb3 UTSW 2 153924808 missense probably damaging 1.00
R6466:Bpifb3 UTSW 2 153922188 missense probably damaging 0.99
R6609:Bpifb3 UTSW 2 153920648 critical splice donor site probably null
R8111:Bpifb3 UTSW 2 153922689 missense probably benign 0.00
R8375:Bpifb3 UTSW 2 153925795 missense probably benign 0.01
R8812:Bpifb3 UTSW 2 153922596 missense probably benign 0.00
R9049:Bpifb3 UTSW 2 153925890 missense probably benign 0.08
Z1177:Bpifb3 UTSW 2 153925789 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGAGCACTTCCAGTTGTTCAG -3'
(R):5'- CCAAGCTTCCTAAGTGTGTGC -3'

Sequencing Primer
(F):5'- TTGTTCAGGAAGGAAGAGCTCC -3'
(R):5'- CCTAAGTGTGTGCTGCTGGC -3'
Posted On 2019-09-13