Incidental Mutation 'R7334:Prss12'
ID569348
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
MMRRC Submission
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123487131 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 488 (L488F)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect probably benign
Transcript: ENSMUST00000029603
AA Change: L488F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: L488F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
P4717OSA:Prss12 UTSW 3 123447618 missense probably damaging 1.00
PIT4576001:Prss12 UTSW 3 123487115 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R3119:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R6864:Prss12 UTSW 3 123447384 missense probably benign 0.31
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7669:Prss12 UTSW 3 123447396 missense probably benign
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R7981:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCTGAAGAGCACTCTGTTTCC -3'
(R):5'- AGACTGCAAGCTTCCAGGAG -3'

Sequencing Primer
(F):5'- CAGGGGTCCTGCCAGAG -3'
(R):5'- AAGCTTCCAGGAGCCCACTTG -3'
Posted On2019-09-13