Incidental Mutation 'R7334:Clca3b'
ID569351
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 144836656 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 462 (R462*)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably null
Transcript: ENSMUST00000159989
AA Change: R462*
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: R462*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTTCTATCCAATGGAGCC -3'
(R):5'- TGTTCTTAACACACTTTGGGTAAG -3'

Sequencing Primer
(F):5'- ATAACAGTTGCCTTGGAGCC -3'
(R):5'- GTAAATTCTACTTGGAACACTACGAC -3'
Posted On2019-09-13