Incidental Mutation 'R7334:Acadm'
ID569352
Institutional Source Beutler Lab
Gene Symbol Acadm
Ensembl Gene ENSMUSG00000062908
Gene Nameacyl-Coenzyme A dehydrogenase, medium chain
SynonymsMCAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location153922357-153944632 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 153939061 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 9 (S9*)
Ref Sequence ENSEMBL: ENSMUSP00000121714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072697] [ENSMUST00000150070] [ENSMUST00000156310]
Predicted Effect probably benign
Transcript: ENSMUST00000072697
SMART Domains Protein: ENSMUSP00000072483
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 42 152 2e-27 PFAM
Pfam:Acyl-CoA_dh_M 157 255 2.3e-26 PFAM
Pfam:Acyl-CoA_dh_1 267 416 1.7e-48 PFAM
Pfam:Acyl-CoA_dh_2 283 405 2.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150070
AA Change: S9*
SMART Domains Protein: ENSMUSP00000121714
Gene: ENSMUSG00000062908
AA Change: S9*

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 36 121 5.4e-21 PFAM
Pfam:Acyl-CoA_dh_M 125 144 5.6e-7 PFAM
Predicted Effect silent
Transcript: ENSMUST00000156310
SMART Domains Protein: ENSMUSP00000122989
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
PDB:2A1T|D 1 77 2e-30 PDB
SCOP:d3mdda2 36 88 2e-9 SMART
low complexity region 101 111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C6- and C12-acylCoA. In mice, deficiency of this gene can cause neonatal mortality as well as fasting and cold intolerance. This gene has multiple, intronless pseudogenes. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display a high degree of postnatal lethality, develop an organic aciduria, fatty liver and an unexpected diffuse cardiomyopathy with multifocal myocyte degeneration and necrosis, and show severe cold intolerance with prior fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Acadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Acadm APN 3 153941970 missense probably damaging 1.00
IGL02598:Acadm APN 3 153938544 splice site probably benign
IGL02642:Acadm APN 3 153939083 missense probably damaging 1.00
R0092:Acadm UTSW 3 153941875 splice site probably benign
R0270:Acadm UTSW 3 153936324 missense possibly damaging 0.89
R1543:Acadm UTSW 3 153929572 missense probably damaging 1.00
R1868:Acadm UTSW 3 153930252 missense probably benign 0.03
R1955:Acadm UTSW 3 153929551 missense probably damaging 0.97
R2281:Acadm UTSW 3 153933043 missense possibly damaging 0.75
R3774:Acadm UTSW 3 153933097 missense probably benign
R4768:Acadm UTSW 3 153922942 missense probably benign 0.00
R4994:Acadm UTSW 3 153929584 missense probably damaging 1.00
R5194:Acadm UTSW 3 153933118 missense possibly damaging 0.63
R5523:Acadm UTSW 3 153938636 missense probably benign 0.13
R5927:Acadm UTSW 3 153939108 missense probably damaging 1.00
R6109:Acadm UTSW 3 153941943 missense probably damaging 1.00
R6223:Acadm UTSW 3 153938549 splice site probably null
R6896:Acadm UTSW 3 153936320 missense probably damaging 0.99
R7108:Acadm UTSW 3 153925800 nonsense probably null
R7182:Acadm UTSW 3 153941881 critical splice donor site probably null
R7440:Acadm UTSW 3 153922989 missense probably damaging 1.00
R7882:Acadm UTSW 3 153938613 nonsense probably null
R7965:Acadm UTSW 3 153938613 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGGCTTACCGCAACTTTC -3'
(R):5'- GAGGTCAGAAGCTTACCTCTTG -3'

Sequencing Primer
(F):5'- AACTTTCCGGAATGTGCGC -3'
(R):5'- TCTGCAGAACAGCTTCATGG -3'
Posted On2019-09-13