Incidental Mutation 'R7334:Ube3b'
ID 569357
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 045371-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7334 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114553742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 974 (F974S)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: F974S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: F974S

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.9624 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,776,380 (GRCm39) C184S probably damaging Het
Acadm G T 3: 153,644,698 (GRCm39) S9* probably null Het
Acot10 C T 15: 20,665,629 (GRCm39) V371I possibly damaging Het
Adam8 T C 7: 139,568,903 (GRCm39) E199G probably damaging Het
Aldh18a1 A T 19: 40,539,696 (GRCm39) W762R probably damaging Het
Aldh1a1 T A 19: 20,599,075 (GRCm39) V162E probably damaging Het
Alms1 A G 6: 85,618,432 (GRCm39) D2357G probably damaging Het
Arfgef1 G T 1: 10,254,685 (GRCm39) Q718K probably damaging Het
Arid5b A C 10: 68,079,007 (GRCm39) V110G possibly damaging Het
Bpifb3 T A 2: 153,761,654 (GRCm39) D34E probably damaging Het
Cacfd1 C T 2: 26,905,558 (GRCm39) A85V possibly damaging Het
Cep57l1 C A 10: 41,597,596 (GRCm39) S345I probably benign Het
Cibar2 T C 8: 120,901,589 (GRCm39) T39A probably damaging Het
Clca3b G A 3: 144,542,417 (GRCm39) R462* probably null Het
Cyp26c1 G A 19: 37,677,323 (GRCm39) V251I probably benign Het
Dip2a A G 10: 76,110,080 (GRCm39) S1179P possibly damaging Het
Dnal1 T C 12: 84,173,780 (GRCm39) L27P probably damaging Het
Dock7 A G 4: 98,864,180 (GRCm39) V1288A unknown Het
Elmod1 A T 9: 53,841,508 (GRCm39) probably null Het
Epb41l5 T G 1: 119,551,679 (GRCm39) K102T probably damaging Het
Fermt3 T C 19: 6,980,406 (GRCm39) I358V probably benign Het
Frmd3 A G 4: 74,079,955 (GRCm39) I316V probably benign Het
Fryl T C 5: 73,204,839 (GRCm39) probably null Het
Gm4131 T A 14: 62,702,356 (GRCm39) H204L possibly damaging Het
Hmcn2 G A 2: 31,325,806 (GRCm39) G4278R probably damaging Het
Hmcn2 A G 2: 31,343,147 (GRCm39) S4558G possibly damaging Het
Igkv1-132 A G 6: 67,737,108 (GRCm39) T25A probably benign Het
Kcp T C 6: 29,485,511 (GRCm39) E1161G probably damaging Het
Macf1 A T 4: 123,293,235 (GRCm39) I5371K probably damaging Het
Malrd1 T A 2: 16,011,529 (GRCm39) C1670S probably damaging Het
Mfsd13a T A 19: 46,356,809 (GRCm39) V270E probably damaging Het
Mroh1 A G 15: 76,311,838 (GRCm39) I524V probably benign Het
Mta1 T C 12: 113,090,418 (GRCm39) S175P possibly damaging Het
Myo7a C T 7: 97,728,573 (GRCm39) R800H probably benign Het
Ncald T A 15: 37,397,524 (GRCm39) Y52F probably damaging Het
Nherf1 C T 11: 115,054,593 (GRCm39) A81V possibly damaging Het
Nomo1 T C 7: 45,732,692 (GRCm39) S1152P probably damaging Het
Nr3c1 A G 18: 39,620,090 (GRCm39) F66L probably benign Het
Nrf1 T C 6: 30,118,970 (GRCm39) L363S probably benign Het
Or4n4 C A 14: 50,519,036 (GRCm39) V225F probably benign Het
Or8b12b A T 9: 37,684,293 (GRCm39) I113F probably damaging Het
Osbpl3 A G 6: 50,321,886 (GRCm39) M300T possibly damaging Het
Parpbp T A 10: 87,947,617 (GRCm39) N339I probably damaging Het
Pdlim5 A T 3: 141,950,678 (GRCm39) H578Q probably damaging Het
Pear1 T C 3: 87,657,532 (GRCm39) N1009S probably damaging Het
Pnpla8 A G 12: 44,358,286 (GRCm39) I745M probably damaging Het
Pom121l12 C A 11: 14,549,681 (GRCm39) T129K probably damaging Het
Ppp1r14a T C 7: 28,992,687 (GRCm39) S130P probably damaging Het
Prss12 A C 3: 123,280,780 (GRCm39) L488F probably benign Het
Psd3 C T 8: 68,361,357 (GRCm39) V559I possibly damaging Het
Rrh T C 3: 129,602,631 (GRCm39) T364A probably benign Het
Shcbp1 A T 8: 4,791,876 (GRCm39) M479K probably damaging Het
Shcbp1 A C 8: 4,804,310 (GRCm39) F200C probably damaging Het
Slx1b G T 7: 126,291,699 (GRCm39) R122S probably damaging Het
Spata31f1e G A 4: 42,793,856 (GRCm39) T92I possibly damaging Het
Spidr A G 16: 15,932,689 (GRCm39) probably null Het
St18 G A 1: 6,872,783 (GRCm39) D173N probably benign Het
Stambpl1 T C 19: 34,204,048 (GRCm39) I46T probably damaging Het
Syne1 C T 10: 5,007,886 (GRCm39) D113N probably damaging Het
Tg G A 15: 66,597,121 (GRCm39) V1741I probably benign Het
Thsd7b T A 1: 130,123,012 (GRCm39) W1544R probably benign Het
Tiam2 G A 17: 3,553,283 (GRCm39) R1120H possibly damaging Het
Tinag A T 9: 76,908,931 (GRCm39) C337S probably damaging Het
Tm4sf1 G C 3: 57,200,510 (GRCm39) A64G probably damaging Het
Tmprss6 A G 15: 78,328,017 (GRCm39) Y572H unknown Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Txndc11 A G 16: 10,946,425 (GRCm39) Y129H probably damaging Het
Utrn C A 10: 12,603,753 (GRCm39) probably null Het
Vmn1r58 T A 7: 5,414,066 (GRCm39) M55L probably benign Het
Vnn1 T A 10: 23,776,658 (GRCm39) S336R probably benign Het
Wwc2 T C 8: 48,322,829 (GRCm39) Y424C unknown Het
Zfp507 T C 7: 35,475,505 (GRCm39) I903V probably damaging Het
Zfp551 C T 7: 12,150,681 (GRCm39) G243R probably damaging Het
Zfp60 T A 7: 27,448,444 (GRCm39) C371S probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TAGTTTCCGGGAGATGAGGC -3'
(R):5'- GCTAAGCACAGTGATGCACAG -3'

Sequencing Primer
(F):5'- CCATGGTATGGGTGCACCTC -3'
(R):5'- ACAGTGATGCACAGGGCCC -3'
Posted On 2019-09-13