Mutagenetix > Incidental Mutation

Incidental Mutation 'R7334:Ube3b'

569357

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

045371-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114415681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 974 (F974S)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074002
AA Change: F974S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: F974S

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.9624

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	T	3: 153,939,061	S9*	probably null	Het
Acot10	C	T	15: 20,665,543	V371I	possibly damaging	Het
Adam8	T	C	7: 139,988,990	E199G	probably damaging	Het
Aldh18a1	A	T	19: 40,551,252	W762R	probably damaging	Het
Aldh1a1	T	A	19: 20,621,711	V162E	probably damaging	Het
Alms1	A	G	6: 85,641,450	D2357G	probably damaging	Het
Arfgef1	G	T	1: 10,184,460	Q718K	probably damaging	Het
Arid5b	A	C	10: 68,243,177	V110G	possibly damaging	Het
Bpifb3	T	A	2: 153,919,734	D34E	probably damaging	Het
Cacfd1	C	T	2: 27,015,546	A85V	possibly damaging	Het
Cep57l1	C	A	10: 41,721,600	S345I	probably benign	Het
Clca3b	G	A	3: 144,836,656	R462*	probably null	Het
Cyp26c1	G	A	19: 37,688,875	V251I	probably benign	Het
Dip2a	A	G	10: 76,274,246	S1179P	possibly damaging	Het
Dnal1	T	C	12: 84,127,006	L27P	probably damaging	Het
Dock7	A	G	4: 98,975,943	V1288A	unknown	Het
Elmod1	A	T	9: 53,934,224		probably null	Het
Epb41l5	T	G	1: 119,623,949	K102T	probably damaging	Het
Fam92b	T	C	8: 120,174,850	T39A	probably damaging	Het
Fermt3	T	C	19: 7,003,038	I358V	probably benign	Het
Frmd3	A	G	4: 74,161,718	I316V	probably benign	Het
Fryl	T	C	5: 73,047,496		probably null	Het
Gm12394	G	A	4: 42,793,856	T92I	possibly damaging	Het
Gm4131	T	A	14: 62,464,907	H204L	possibly damaging	Het
Gm8298	T	A	3: 59,868,959	C184S	probably damaging	Het
Hmcn2	G	A	2: 31,435,794	G4278R	probably damaging	Het
Hmcn2	A	G	2: 31,453,135	S4558G	possibly damaging	Het
Igkv1-132	A	G	6: 67,760,124	T25A	probably benign	Het
Kcp	T	C	6: 29,485,512	E1161G	probably damaging	Het
Macf1	A	T	4: 123,399,442	I5371K	probably damaging	Het
Malrd1	T	A	2: 16,006,718	C1670S	probably damaging	Het
Mfsd13a	T	A	19: 46,368,370	V270E	probably damaging	Het
Mroh1	A	G	15: 76,427,638	I524V	probably benign	Het
Mta1	T	C	12: 113,126,798	S175P	possibly damaging	Het
Myo7a	C	T	7: 98,079,366	R800H	probably benign	Het
Ncald	T	A	15: 37,397,280	Y52F	probably damaging	Het
Nomo1	T	C	7: 46,083,268	S1152P	probably damaging	Het
Nr3c1	A	G	18: 39,487,037	F66L	probably benign	Het
Nrf1	T	C	6: 30,118,971	L363S	probably benign	Het
Olfr732	C	A	14: 50,281,579	V225F	probably benign	Het
Olfr875	A	T	9: 37,772,997	I113F	probably damaging	Het
Osbpl3	A	G	6: 50,344,906	M300T	possibly damaging	Het
Parpbp	T	A	10: 88,111,755	N339I	probably damaging	Het
Pdlim5	A	T	3: 142,244,917	H578Q	probably damaging	Het
Pear1	T	C	3: 87,750,225	N1009S	probably damaging	Het
Pnpla8	A	G	12: 44,311,503	I745M	probably damaging	Het
Pom121l12	C	A	11: 14,599,681	T129K	probably damaging	Het
Ppp1r14a	T	C	7: 29,293,262	S130P	probably damaging	Het
Prss12	A	C	3: 123,487,131	L488F	probably benign	Het
Psd3	C	T	8: 67,908,705	V559I	possibly damaging	Het
Rrh	T	C	3: 129,808,982	T364A	probably benign	Het
Shcbp1	A	T	8: 4,741,876	M479K	probably damaging	Het
Shcbp1	A	C	8: 4,754,310	F200C	probably damaging	Het
Slc9a3r1	C	T	11: 115,163,767	A81V	possibly damaging	Het
Slx1b	G	T	7: 126,692,527	R122S	probably damaging	Het
Spidr	A	G	16: 16,114,825		probably null	Het
St18	G	A	1: 6,802,559	D173N	probably benign	Het
Stambpl1	T	C	19: 34,226,648	I46T	probably damaging	Het
Syne1	C	T	10: 5,057,886	D113N	probably damaging	Het
Tg	G	A	15: 66,725,272	V1741I	probably benign	Het
Thsd7b	T	A	1: 130,195,275	W1544R	probably benign	Het
Tiam2	G	A	17: 3,503,008	R1120H	possibly damaging	Het
Tinag	A	T	9: 77,001,649	C337S	probably damaging	Het
Tm4sf1	G	C	3: 57,293,089	A64G	probably damaging	Het
Tmprss6	A	G	15: 78,443,817	Y572H	unknown	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Txndc11	A	G	16: 11,128,561	Y129H	probably damaging	Het
Utrn	C	A	10: 12,728,009		probably null	Het
Vmn1r58	T	A	7: 5,411,067	M55L	probably benign	Het
Vnn1	T	A	10: 23,900,760	S336R	probably benign	Het
Wwc2	T	C	8: 47,869,794	Y424C	unknown	Het
Zfp507	T	C	7: 35,776,080	I903V	probably damaging	Het
Zfp551	C	T	7: 12,416,754	G243R	probably damaging	Het
Zfp60	T	A	7: 27,749,019	C371S	probably damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TAGTTTCCGGGAGATGAGGC -3'
(R):5'- GCTAAGCACAGTGATGCACAG -3'

Sequencing Primer
(F):5'- CCATGGTATGGGTGCACCTC -3'
(R):5'- ACAGTGATGCACAGGGCCC -3'

Posted On

2019-09-13