Incidental Mutation 'R7334:Nrf1'
ID569359
Institutional Source Beutler Lab
Gene Symbol Nrf1
Ensembl Gene ENSMUSG00000058440
Gene Namenuclear respiratory factor 1
SynonymsD6Ertd415e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30047988-30153458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30118971 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 363 (L363S)
Ref Sequence ENSEMBL: ENSMUSP00000110867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004761] [ENSMUST00000069808] [ENSMUST00000069831] [ENSMUST00000115199] [ENSMUST00000115200] [ENSMUST00000115204] [ENSMUST00000115206] [ENSMUST00000115208] [ENSMUST00000115209] [ENSMUST00000115211] [ENSMUST00000115212] [ENSMUST00000167972] [ENSMUST00000170535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004761
AA Change: L363S

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004761
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
low complexity region 475 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069808
AA Change: L363S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065568
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 283 1.1e-119 PFAM
low complexity region 285 294 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:YchF-GTPase_C 448 526 2.2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000069831
AA Change: L375S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067447
Gene: ENSMUSG00000058440
AA Change: L375S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 87 297 3.3e-132 PFAM
low complexity region 389 406 N/A INTRINSIC
low complexity region 421 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115199
AA Change: L375S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110853
Gene: ENSMUSG00000058440
AA Change: L375S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 87 297 3.3e-132 PFAM
low complexity region 389 406 N/A INTRINSIC
low complexity region 421 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115200
AA Change: L363S

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110854
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
low complexity region 475 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115204
AA Change: L363S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110858
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.2e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115206
AA Change: L363S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110860
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 3.3e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:YchF-GTPase_C 448 526 3.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115208
AA Change: L363S

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110863
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 1.6e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115209
AA Change: L363S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110864
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.9e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:Nrf1_activ_bdg 449 503 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115211
AA Change: L363S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110866
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.9e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:Nrf1_activ_bdg 449 503 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115212
AA Change: L363S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110867
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.9e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:Nrf1_activ_bdg 449 503 1.2e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114451
Gene: ENSMUSG00000058440
AA Change: L101S

DomainStartEndE-ValueType
Pfam:Nrf1_DNA-bind 1 22 1.1e-9 PFAM
low complexity region 24 33 N/A INTRINSIC
low complexity region 116 133 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167972
AA Change: L363S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130108
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.9e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
low complexity region 409 423 N/A INTRINSIC
Pfam:Nrf1_activ_bdg 449 503 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170535
AA Change: L363S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132637
Gene: ENSMUSG00000058440
AA Change: L363S

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Pfam:Nrf1_DNA-bind 75 285 2.2e-132 PFAM
low complexity region 377 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth. Alternative splicing results in multiple transcript variants. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene and for "nuclear factor (erythroid-derived 2)-like 1" which has an official symbol of NFE2L1. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality between E3.5 and E6.5 associated with decreased cellular proliferation and mitochondrial DNA content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Adam8 T C 7: 139,988,990 E199G probably damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Nrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Nrf1 APN 6 30098478 missense probably damaging 1.00
IGL00909:Nrf1 APN 6 30098478 missense probably damaging 1.00
IGL01556:Nrf1 APN 6 30126367 intron probably benign
IGL02371:Nrf1 APN 6 30118991 missense possibly damaging 0.90
IGL03345:Nrf1 APN 6 30089948 missense probably damaging 0.99
R1892:Nrf1 UTSW 6 30144788 missense probably null
R4097:Nrf1 UTSW 6 30151672 nonsense probably null
R5347:Nrf1 UTSW 6 30118968 missense probably benign 0.05
R5607:Nrf1 UTSW 6 30126246 missense probably damaging 1.00
R5654:Nrf1 UTSW 6 30117062 missense probably benign 0.22
R5851:Nrf1 UTSW 6 30089976 missense possibly damaging 0.92
R6470:Nrf1 UTSW 6 30102200 missense probably damaging 0.99
R7106:Nrf1 UTSW 6 30102184 missense probably benign
R7476:Nrf1 UTSW 6 30116272 missense probably damaging 1.00
R7510:Nrf1 UTSW 6 30151634 missense possibly damaging 0.94
R7625:Nrf1 UTSW 6 30116231 missense probably benign 0.20
R7882:Nrf1 UTSW 6 30090300 missense probably benign 0.01
R7965:Nrf1 UTSW 6 30090300 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTTAGTCTTCCAGAACTACTTGG -3'
(R):5'- TTAGCACAGGCCTGCAATCC -3'

Sequencing Primer
(F):5'- CTTCCAGAACTACTTGGTATAGACAC -3'
(R):5'- AGGCCTGCAATCCCAGTC -3'
Posted On2019-09-13