Incidental Mutation 'R7334:Adam8'
ID569371
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Namea disintegrin and metallopeptidase domain 8
SynonymsCD156, MS2, E430039A18Rik, CD156a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7334 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139978932-139992562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139988990 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 199 (E199G)
Ref Sequence ENSEMBL: ENSMUSP00000101684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]
Predicted Effect probably damaging
Transcript: ENSMUST00000026546
AA Change: E198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: E198G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106069
AA Change: E199G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: E199G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473
AA Change: E198G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G T 3: 153,939,061 S9* probably null Het
Acot10 C T 15: 20,665,543 V371I possibly damaging Het
Aldh18a1 A T 19: 40,551,252 W762R probably damaging Het
Aldh1a1 T A 19: 20,621,711 V162E probably damaging Het
Alms1 A G 6: 85,641,450 D2357G probably damaging Het
Arfgef1 G T 1: 10,184,460 Q718K probably damaging Het
Arid5b A C 10: 68,243,177 V110G possibly damaging Het
Bpifb3 T A 2: 153,919,734 D34E probably damaging Het
Cacfd1 C T 2: 27,015,546 A85V possibly damaging Het
Cep57l1 C A 10: 41,721,600 S345I probably benign Het
Clca3b G A 3: 144,836,656 R462* probably null Het
Cyp26c1 G A 19: 37,688,875 V251I probably benign Het
Dip2a A G 10: 76,274,246 S1179P possibly damaging Het
Dnal1 T C 12: 84,127,006 L27P probably damaging Het
Dock7 A G 4: 98,975,943 V1288A unknown Het
Elmod1 A T 9: 53,934,224 probably null Het
Epb41l5 T G 1: 119,623,949 K102T probably damaging Het
Fam92b T C 8: 120,174,850 T39A probably damaging Het
Fermt3 T C 19: 7,003,038 I358V probably benign Het
Frmd3 A G 4: 74,161,718 I316V probably benign Het
Fryl T C 5: 73,047,496 probably null Het
Gm12394 G A 4: 42,793,856 T92I possibly damaging Het
Gm4131 T A 14: 62,464,907 H204L possibly damaging Het
Gm8298 T A 3: 59,868,959 C184S probably damaging Het
Hmcn2 G A 2: 31,435,794 G4278R probably damaging Het
Hmcn2 A G 2: 31,453,135 S4558G possibly damaging Het
Igkv1-132 A G 6: 67,760,124 T25A probably benign Het
Kcp T C 6: 29,485,512 E1161G probably damaging Het
Macf1 A T 4: 123,399,442 I5371K probably damaging Het
Malrd1 T A 2: 16,006,718 C1670S probably damaging Het
Mfsd13a T A 19: 46,368,370 V270E probably damaging Het
Mroh1 A G 15: 76,427,638 I524V probably benign Het
Mta1 T C 12: 113,126,798 S175P possibly damaging Het
Myo7a C T 7: 98,079,366 R800H probably benign Het
Ncald T A 15: 37,397,280 Y52F probably damaging Het
Nomo1 T C 7: 46,083,268 S1152P probably damaging Het
Nr3c1 A G 18: 39,487,037 F66L probably benign Het
Nrf1 T C 6: 30,118,971 L363S probably benign Het
Olfr732 C A 14: 50,281,579 V225F probably benign Het
Olfr875 A T 9: 37,772,997 I113F probably damaging Het
Osbpl3 A G 6: 50,344,906 M300T possibly damaging Het
Parpbp T A 10: 88,111,755 N339I probably damaging Het
Pdlim5 A T 3: 142,244,917 H578Q probably damaging Het
Pear1 T C 3: 87,750,225 N1009S probably damaging Het
Pnpla8 A G 12: 44,311,503 I745M probably damaging Het
Pom121l12 C A 11: 14,599,681 T129K probably damaging Het
Ppp1r14a T C 7: 29,293,262 S130P probably damaging Het
Prss12 A C 3: 123,487,131 L488F probably benign Het
Psd3 C T 8: 67,908,705 V559I possibly damaging Het
Rrh T C 3: 129,808,982 T364A probably benign Het
Shcbp1 A T 8: 4,741,876 M479K probably damaging Het
Shcbp1 A C 8: 4,754,310 F200C probably damaging Het
Slc9a3r1 C T 11: 115,163,767 A81V possibly damaging Het
Slx1b G T 7: 126,692,527 R122S probably damaging Het
Spidr A G 16: 16,114,825 probably null Het
St18 G A 1: 6,802,559 D173N probably benign Het
Stambpl1 T C 19: 34,226,648 I46T probably damaging Het
Syne1 C T 10: 5,057,886 D113N probably damaging Het
Tg G A 15: 66,725,272 V1741I probably benign Het
Thsd7b T A 1: 130,195,275 W1544R probably benign Het
Tiam2 G A 17: 3,503,008 R1120H possibly damaging Het
Tinag A T 9: 77,001,649 C337S probably damaging Het
Tm4sf1 G C 3: 57,293,089 A64G probably damaging Het
Tmprss6 A G 15: 78,443,817 Y572H unknown Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Txndc11 A G 16: 11,128,561 Y129H probably damaging Het
Ube3b T C 5: 114,415,681 F974S possibly damaging Het
Utrn C A 10: 12,728,009 probably null Het
Vmn1r58 T A 7: 5,411,067 M55L probably benign Het
Vnn1 T A 10: 23,900,760 S336R probably benign Het
Wwc2 T C 8: 47,869,794 Y424C unknown Het
Zfp507 T C 7: 35,776,080 I903V probably damaging Het
Zfp551 C T 7: 12,416,754 G243R probably damaging Het
Zfp60 T A 7: 27,749,019 C371S probably damaging Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139987245 missense probably damaging 1.00
IGL02044:Adam8 APN 7 139982822 missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139988806 splice site probably null
IGL02257:Adam8 APN 7 139987648 missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139988543 missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139986442 missense probably damaging 1.00
R0384:Adam8 UTSW 7 139986812 unclassified probably benign
R1169:Adam8 UTSW 7 139983929 missense probably benign 0.11
R1340:Adam8 UTSW 7 139991377 missense probably damaging 0.99
R1699:Adam8 UTSW 7 139983311 missense possibly damaging 0.72
R3725:Adam8 UTSW 7 139983868 missense possibly damaging 0.63
R3874:Adam8 UTSW 7 139987607 missense probably damaging 1.00
R4716:Adam8 UTSW 7 139983938 missense probably benign 0.31
R4754:Adam8 UTSW 7 139984780 missense possibly damaging 0.87
R4907:Adam8 UTSW 7 139989373 missense probably benign 0.03
R5345:Adam8 UTSW 7 139987639 missense probably benign 0.03
R5579:Adam8 UTSW 7 139988984 missense probably benign 0.03
R5696:Adam8 UTSW 7 139989246 missense probably benign 0.03
R5805:Adam8 UTSW 7 139985881 missense probably damaging 1.00
R5948:Adam8 UTSW 7 139987884 missense probably benign 0.07
R5991:Adam8 UTSW 7 139990287 missense probably damaging 1.00
R6280:Adam8 UTSW 7 139984807 missense probably damaging 0.99
R6456:Adam8 UTSW 7 139986788 missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139979499 missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139990055 missense probably benign 0.00
R7342:Adam8 UTSW 7 139986391 missense probably benign 0.00
R7382:Adam8 UTSW 7 139990107 missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139992481 unclassified probably benign
R7507:Adam8 UTSW 7 139987178 critical splice donor site probably null
R7637:Adam8 UTSW 7 139985430 missense probably damaging 0.98
R7904:Adam8 UTSW 7 139987678 missense probably benign 0.17
R8024:Adam8 UTSW 7 139987576 missense probably damaging 1.00
R8176:Adam8 UTSW 7 139988873 missense probably benign 0.03
R8438:Adam8 UTSW 7 139985336 critical splice donor site probably null
R8439:Adam8 UTSW 7 139987849 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTCACTGTCAGCACACCTGG -3'
(R):5'- ATGGCTCTCTGTAGCCCTGAAG -3'

Sequencing Primer
(F):5'- ACCTTGTCCACGTGGTTTACAAC -3'
(R):5'- TCTCTGTAGCCCTGAAGCAAGC -3'
Posted On2019-09-13